J Biol Chem, Vol. 273, Issue 27, 17036-17049, July 3, 1998
Identification of the Binding Site on Cytochrome P450 2B4 for
Cytochrome b5 and Cytochrome P450
Reductase*
Angela
Bridges
§,
Larry
Gruenke¶,
Yan-Tyng
Chang
,
Ilya A.
Vakser**,
Gilda
Loew
, and
Lucy
Waskell¶
From the ¶ Department of Anesthesia and the Liver
Center, University of California, San Francisco, California 94143, the
Department of Anesthesia, Veterans Affairs Medical
Center, San Francisco, California 94121, the
Molecular
Research Institute, Palo Alto, California 94304, and the
** Department of Pharmacology, Medical University of South Carolina,
Charleston, South Carolina 29425
 |
ABSTRACT |
A model of cytochrome P450 2B4, which was
constructed by homology modeling with the four known crystal structures
of the cytochromes P450 (Chang, T.-T., Stiffelman, O. B., Vakser,
I. A., Loew, G. H., Bridges, A., and Waskell, L. (1997)
Protein Eng. 10, 119-129), was used to select amino acids
predicted, by computer docking studies and numerous previous
biochemical and site-directed mutagenesis studies, to be involved in
binding the heme domain of cytochrome b5.
Twenty-four amino acid residues located on both the distal and the
proximal surface of the molecule were chosen for mutagenesis. These 24 mutant proteins were expressed in Escherichia coli,
purified, and characterized with respect to their ability to bind
cytochrome b5 and support substrate oxidation.
Seven mutants, R122A, R126A, R133A, F135A, M137A, K139A, and K433A, all
on the proximal surface of cytochrome P450 2B4 near the heme ligand,
were identified that exhibited decreased ability to bind cytochrome
b5. All of the mutants except K433A are located
in either the C or C* helices or their termini. In addition, these
seven mutants and two additional mutants on the proximal surface of
cytochrome P450, R422A and R443A, were shown to exhibit decreased
binding to cytochrome P450 reductase. These studies indicate that the
binding sites for cytochrome b5 and cytochrome
P450 reductase are, as predicted, located on the proximal surface of
cytochrome P450 2B4 and are partially overlapping but not
identical.
 |
INTRODUCTION |
The cytochromes P450
(P450s)1 are a ubiquitous
superfamily of mixed function oxidases that catalyze the oxidation of a
large number of hydrophobic endogenous and xenobiotic substrates. Known substrates number in the thousands, whereas unique P450 sequences are
counted in the hundreds at this time (2-4). The versatility of these
oxidases and their potential for industrial purposes has generated a
great deal of interest in understanding their structure, function, and
redox reactions. The reaction catalyzed by P450 is shown in Reaction
1.
|
(Reaction 1)
|
where RH is the substrate and ROH is the oxidized product. The
enzymatic cycle includes substrate binding, first electron transfer,
oxygen binding, second electron transfer, substrate oxidation, and
finally product dissociation. The redox partners for the microsomal
P450s are cytochrome P450 reductase (P450 reductase) which contains
both a FAD and FMN cofactor and cytochrome b5
(cyt b5). The crystal structure of P450
reductase has recently been published, and the two domains of the
enzyme have been individually expressed and characterized (5, 6). In
contrast, the crystal structure of cyt b5 has
been known for many years but has just recently been refined (7, 8).
The first and second electrons are donated to P450 by P450 reductase.
Because of its redox potential (
+ 25 mV), cyt
b5 can only donate the second electron to P450 (9). In fact, it has been suggested that cyt b5
may be able to transfer the second electron to selected P450s even
faster than P450 reductase, thereby decreasing the amount of superoxide produced (10-12).
In an attempt to understand more thoroughly the in vitro and
in vivo regulation and mechanism of reduction of P450 by its redox partners, the functional binding site on cytochrome P450 2B4
(CYP2B4) for cyt b5 and P450 reductase has been
identified. A model of the microsomal CYP2B4 has been constructed based
on the previously determined crystal structures of four bacterial P450s
(1), and residues on both the proximal and distal face of CYP2B4 have
been mutated and characterized. Herein, we report that, as predicted,
the site for binding cyt b5 and P450 reductase is located on the proximal surface of CYP2B4 where the heme comes closest to the surface (3, 13, 14).
 |
EXPERIMENTAL PROCEDURES |
Materials--
Yeast extract and tryptone for Escherichia
coli growth media were obtained from Difco. Restriction
endonucleases, T4 DNA ligase, and Vent DNA polymerase were obtained
from New England Biolabs (Beverly, MA). Ampicillin, chloramphenicol,
NADPH, isopropyl thiogalactopyranoside,
-aminolevulinic acid,
lysozyme, polyethoxyethylene 9 lauryl ether, phenylmethylsulfonyl
fluoride, Tergitol NP-10, hemin, and Reactive Red-agarose were
purchased from Sigma. Aprotinin, benzamidine, bestatin, leupeptin, and
pepstatin were purchased from Calbiochem (San Diego, CA). DNase I and
RNase A were obtained from Boehringer Mannheim (Germany).
Methoxyflurane containing 0.01% (w/w) butylated hydroxytoluene was
purchased from Abbott Laboratories (Chicago, IL). Benzphetamine
hydrochloride was a gift of the Upjohn Co. (Kalamazoo, MI).
Dilaurylphosphatidylcholine was purchased from Serdary Research
Laboratories (Englewood Cliffs, NJ). Bio-Gel HTP hydroxylapatite was
obtained from Bio-Rad. DE52 cellulose was purchased from Whatman
(Maidstone, UK). DEAE-Sepharose Fast Flow resin was obtained from
Amersham Pharmacia Biotech (Uppsala, Sweden). CYP2B4 B0 cDNA was
kindly supplied by Dr. R. M. Philpot (NIEHS, Research Triangle
Park, NC) (15). pCWOri+ plasmid DNA was the gift of Professor M. Waterman (Vanderbilt University School of Medicine, Nashville, TN)
(16).
Construction of the Plasmids Used to Express CYP2B4 and Its
Mutants--
Unless otherwise specified, all DNA manipulations were
performed as described (17). All mutations were confirmed by
double-stranded cycle sequencing using an Applied Biosystems 373 Stretch Sequencer and Ampli-Taq FS. Primer synthesis for
site-directed mutagenesis and DNA sequencing was performed by the
Biomolecular Resource Center at the University of California, San
Francisco. The purpose of the following experiments (summarized in
Figs. 1-3) was to insert the coding
region of the CYP2B4 (B0) cDNA downstream of the T7 promoter for overexpression in E. coli. CYP2B4 cDNA (15)
containing an extra 500 bp at the C terminus of the P450 gene was
digested with NcoI and EcoRI and cloned into
pET-23d (low copy origin of replication from PBR-322) and pLWO1 (high
copy origin of replication) to generate expression plasmids pET-P450
extratail and pLW-P450 extratail, respectively (Fig.
2). pLW01 (Fig. 1) was generated by
ligating NaeI/PvuII-digested pET-23d (Novagen,
Madison, WI) with NaeI/PvuII-digested pBluescript
II KS+ (Stratagene, La Jolla, CA). pLW01 contains the bacteriophage
T7 promoter, upstream of an NcoI (CCATGG)
multi-cloning site coincident with the ATG start codon, and a high copy
origin of replication (ColE1) from pBluescript II KS(+).
pLW-P450extratail contained 500 bp of noncoding DNA at the 3' end of
the sequence, which was subsequently removed using PCR (Fig. 2). A
5'-oligonucleotide primer complementary to the unique RsrII
restriction (1328 bp from the ATG start codon of the CYP2B4 gene) was
synthesized (AAGGCATCGCGCGGACCGAG, RsrII site
underlined). A 3'-oligonucleotide primer was synthesized which
contained a unique HindIII site
(GTCCCCGAAGCTTCATCAGCG, HindIII site underlined)
a few base pairs downstream of the CYP2B4 stop codon. All PCR reactions
were performed in a volume of 100 µl and contained 2 units of
VentTM DNA polymerase in the recommended buffer, 1-2
µM of each primer, and 200 µM dNTPs. The
DNA was melted at 95 °C for 5 min in a Minicycler (MJ Research,
Inc., Watertown, MA) and subsequently amplified using a temperature
program of 45 s at 95 °C, 45 s at 55 °C, and 1.5 min at
72 °C for 30 cycles. The product of the PCR reaction was digested
with RsrII and HindIII and cloned into
RsrII/HindIII-digested pLW-P450 extratail to
generate the expression plasmid pLW-P450.
In order to express CYP2B4 protein with either a 4-, 6-, or
10-histidine tag upstream of a Factor Xa cleavage site at the N
terminus of wild-type P450, appropriate plasmids were constructed as
follows. To generate the 10 His-tagged construct, it was necessary to
introduce unique 5'-NdeI and 3'-HindIII
restriction sites into the P450 gene. A 5'-oligonucleotide primer was
synthesized encoding an NdeI site coincident with the ATG
start codon of the CYP2B4 gene (GATATACATATGGAATTCAGCC,
NdeI site underlined). The 3' primer contained an
HindIII restriction endonuclease site a few base pairs
downstream of the CYP2B4 stop codon (primer sequence described above).
After annealing of the primers to the CYP2B4 cDNA, the gene was
amplified by PCR, digested with NdeI and HindIII,
and cloned into NdeI/HindIII-digested pET-16b
(Novagen, Madison, WI), which encodes a 10 His tag upstream of the
factor Xa protease cleavage site and the multiple cloning site. This
generated the expression plasmid pET16b-10HisP450. The high copy
expression plasmid pLW-10HisP450 was then generated by digesting
pET16b-10HisP450 with NcoI and HindIII and
subcloning the NcoI/HindIII fragment containing
the P450 sequence into NcoI/HindIII-digested
pLW01. The 4 and 6 His-tagged N-terminal constructs were generated by PCR, using pLW-10HisP450 as the template and
GTCCCCGAAGCTTCATCAGCG (HindIII site underlined)
as the 3' primer. The 5' primers for the 6-His tag and 4-His tag were
ATATACCATGGGCCATCATCATCATCATCACAGCAGC and
ATATACCATGGGCCATCATCATCACAGCAGC, respectively
(NcoI site underlined in both primers). After annealing of
the primers to pLW-10HisP450, the P450 DNA was amplified, and the PCR
products were digested with NcoI and HindIII.
Following digestion, the DNA fragments were cloned into
NcoI/HindIII-digested pLW01 (Fig. 1), generating the expression plasmids pLW-6HisP450 and pLW-4His P450.
To express a P450 with 4 histidines at its C terminus (not
illustrated), a 3'-oligonucleotide primer was synthesized that encoded
4 His residues after the last amino acid of the CYP2B4 gene and
upstream of the stop codon and the 3'-HindIII site
(ATCGATAAGCTTCAATGGTGATGGTGACGGGCCAGG, HindIII
site underlined). The 5' primer was hybridized to a segment of the P450
sequence encoding the unique RsrII site (1348 bp from the
ATG start codon, primer sequence described above). After annealing of
the primers to pLW-P450, the CYP2B4 gene was amplified by PCR as
described above. The PCR product was digested with RsrII and HindIII and cloned into RsrII/HindIII
digested pLW-P450 to generate the expression plasmid pLW-P450-4His
tail.
A second expression plasmid was generated containing the CYP2B4 DNA
sequence and the vector pCWOri+, which contains a tandem tac-tac promoter (16). To clone the CYP2B4 gene
into pCWOri+, it was necessary to introduce unique 5'-NdeI
and 3'-HindIII restriction sites into the P450 gene which
was in the plasmid, pLW-450. A 5'-oligonucleotide primer was
synthesized encoding an NdeI site coincident with the ATG
start codon (GGAGATATACATATGGAATTCAGCC, NdeI
site underlined). The 3'-primer contained a HindIII site a
few base pairs downstream of the CYP2B4 stop codon (primer sequence described above). After annealing of the primers to the CYP2B4 cDNA, the gene was amplified by PCR, digested with NdeI
and HindIII, and cloned into
NdeI/HindIII-digested pCWOri+ to produce the
expression vector pCW-P450.
Construction of N-terminal Signal Sequence Mutants of
CYP2B4--
Mutations were introduced into the N-terminal signal
sequence of the P450 DNA using PCR with the plasmid pLW-P450 as a
template. The N-terminally mutated P450 genes were cloned into two
vectors, pKK223-3 (tac promoter) and pLW01 (T7
promoter) to determine whether there was any difference in expression
from the different promoters. To facilitate cloning into both pKK223-3
and pLW01, both EcoRI (for pKK223-3) and NcoI
(for pLW01) sites were encoded in the mutagenic primers. Two mutants
were constructed as follows: in the first mutant a single amino acid
(E2A) was changed and in the second mutant 5 amino acids (E2A, F3L,
S4L, L6A, L7V) were changed. The 5'-oligonucleotide primers synthesized
for mutant 1 (E2A) and for mutant 2 had the following sequences:
CTCAGAATTCACCATGGCTTTCAGCCTGCTCCTCCTC and
CTGAGAATTCACCATGGCTCTGTTACTGGCAGTTCTCCTGGCTTTCCTCGCAGGC, respectively (NcoI site underlined, EcoRI
site in bold). The 3' primer encoded a HindIII restriction
site downstream of the stop codon (primer sequence described above).
After annealing of the primers to pLW-P450, the P450 DNA was amplified,
and the PCR products were digested with EcoRI and
HindIII. They were then cloned into the
EcoRI/HindIII-digested vector pKK223-3 (Amersham
Pharmacia Biotech, Uppsala, Sweden), which contains a tac
promoter, to generate the plasmids pKK-P450Nmut1 and pKK-P450Nmut2.
These plasmids were then digested with NcoI and
HindIII, and the mutated CYP2B4 fragments were cloned into
NcoI/HindIII-digested pLW01 to generate the
plasmids pLW-P450Nmut1 and pLW-P450Nmut2.
Site-directed Mutagenesis--
To facilitate the generation of
numerous mutants of CYP2B4, four unique restriction sites were
introduced via silent mutations into the CYP2B4 cDNA (Fig.
3). The four unique restriction sites are
as follows: KpnI (241 bp from ATG start codon),
SpeI (522 bp from ATG start codon), EcoRI (843 bp
from ATG start codon), and XbaI (1238 bp from ATG start
codon). The sequences of the oligonucleotides used to introduce these
restriction sites are as follows: for KpnI,
CTCGCGGATGGCATCGGTACCGCACAGCACGACCACGGG (KpnI
site underlined); for SpeI,
AATGGAGCAGATGATGTTACTAGTGATTGAGTGGAAGAC (SpeI
site underlined); for EcoRI,
GTTCTGGTGGTGGAATTCGCTGCTTGGGTGGA (EcoRI site
underlined); and for XbaI,
TGCCCCGTTGCCATCTAGAAAGTGGCCGGGG (XbaI site
underlined). All four oligonucleotide primers were annealed to pLW-P450
in one reaction, and site-directed mutagenesis to produce the plasmid
pLW-P450-EKSX was accomplished using a Muta-Gene Phagemid in
vitro mutagenesis kit from Bio-Rad. Following mutagenesis to form
the internal restriction sites, KpnI/SpeI-, SpeI/EcoRI-, EcoRI/XbaI-,
and XbaI/HindIII-digested fragments of the CYP2B4
gene were excised from pLW-P450-EKSX and subcloned into the phagemid
vectors pET-23a (Novagen, Madison, WI) or pTZ18U (Bio-Rad) for further
mutagenesis. To generate the 24 alanine mutants of CYP2B4, 24 oligonucleotide primers were synthesized. Sequences of the
oligonucleotides are shown in Table I.
Site-directed mutagenesis was again accomplished using a Muta-Gene
Phagemid in vitro mutagenesis kit from Bio-Rad. Following
mutagenesis, correctly mutated P450 DNA fragments were excised from the
mutagenesis vectors and subcloned into the expression vector
pLW-P450-EKSX for expression in E. coli.
Expression of Wild-type and Mutant CYP2B4 in E. coli--
The
appropriate CYP2B4 (both wild-type and mutated) containing plasmid DNA
was transformed into E. coli JM109 (DE3) cells containing
pLysS (Novagen, Madison, WI) and grown overnight at 30 °C on
Luria-Bertani (LB) agar plates containing 1 mM thiamine, 100 µg/ml ampicillin, and 74 µg/ml chloramphenicol. 3 ml of LB medium containing 1 mM thiamine, 100 µg/ml ampicillin,
and 74 µg/ml chloramphenicol were inoculated with a single
transformed colony and grown overnight at 30 °C, 200 rpm. 2 ml of
this culture were then used to inoculate 100 ml of terrific broth (18)
containing 1 mM thiamine, 0.5 mM
-aminolevulinic acid, 100 µg/ml ampicillin, and 74 µg/ml
chloramphenicol in a 500-ml Erlenmeyer flask. The cultures were grown
at room temperature (approximately 25 °C), 120 rpm, until they
reached an A600 of at least 4, and then IPTG was
added to a final concentration of 0.1 mM to induce
expression. The cultures were then incubated for a further 72 h at
room temperature (approximately 25 °C), with shaking at 120 rpm.
Overexpression of wild-type CYP2B4 was attempted on a larger scale (200 ml of medium in a 1000-ml Erlenmeyer flask and 750 ml in a 2800-ml
Fernbach flask), but the yield of holo-P450 obtained was reduced by
50-70%.
Purification of Wild-type CYP2B4 from E. coli
--
Unless
otherwise specified, all operations were performed at 4 °C. Cells
expressing P450, from 4000 ml of cell culture medium, were harvested by
centrifugation at 4000 × g for 25 min, and the pellet
was resuspended in 60 ml of buffer A (100 mM potassium phosphate, pH 7.4, 20% glycerol, 0.1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM
benzamidine, 0.3 µM aprotinin, 130 µM
bestatin, 1 µM leupeptin, 1 µM pepstatin, 1 mg/ml lysozyme, 0.1 mg/ml RNase, 0.1 mg/ml DNase). The solution was
stirred for 1 h at 4 °C and then frozen at
80 °C for
1 h. After thawing, the cycle of stirring, freezing, and thawing
was repeated twice for a total of three times. The cells were lysed by
sonication in an ice/salt bath using a Vibra Cell High Intensity
Ultrasonic Processor (Sonics and Materials, Inc., Danbury, CT) for a
total of 6 min at 40% power in 30-s pulses, with 5 min for cooling
after each pulse. Unbroken cells were removed by centrifugation at
3000 × g for 15 min, and the supernatant was
ultracentrifuged at 105,000 × g for 1 h to pellet
the "membrane fraction." The supernatant was discarded, and the
pellet was resuspended in 40 ml of buffer B (10 mM
potassium phosphate, pH 7.4, 20% glycerol, 0.1 mM EDTA, 0.6% polyethoxyethylene 9 lauryl ether) by stirring for 3 h at 4 °C. After the pellet had been completely resuspended,
polyethoxyethylene 9 lauryl ether was added dropwise to the solution to
a final ratio of 5:1, milligram of detergent:milligram of protein. The
solution was stirred for 2 h at 4 °C and subsequently
centrifuged at 105,000 × g for 1 h. The
P450-containing supernatant was decanted and loaded directly onto a
Reactive Red-agarose column (100 nmol of P450/ml of Reactive
Red-agarose) pre-equilibrated with 10 volumes of buffer B. After
loading the P450-containing supernatant, the column was washed with
buffer C (10 mM potassium phosphate, pH 7.4, 20% glycerol,
0.1 mM EDTA, 0.3% Tergitol NP-10) at the same rate until
the A418 of the eluant was below 0.05. Subsequently, the column was washed with 4 column volumes of buffer C
containing 100 mM NaCl to elute weakly binding proteins.
CYP2B4 was eluted with buffer C containing 500 mM NaCl.
Fractions containing P450 were combined, dialyzed overnight against 100 volumes of buffer C, and loaded onto a Bio-Gel HTP hydroxylapatite
column (30 nmol of P450/ml of hydroxylapatite), pre-equilibrated with
10 volumes of buffer D (5 mM potassium phosphate, pH 7.4, 20% glycerol, 0.1 mM EDTA). After loading the CYP2B4
containing fractions, the hydroxylapatite column was washed with buffer
D until the A275 of the eluant was below 0.005. P450 was eluted using buffer E (500 mM potassium phosphate,
pH 7.4, 20% glycerol, 0.1 mM EDTA), and the fractions containing P450 were combined and dialyzed overnight against 100 volumes of buffer F (50 mM potassium phosphate, pH 7.4, 20% glycerol, 0.1 mM EDTA). After dialysis, the fractions
were concentrated to 100-300 µM P450 using an Amicon
centricon apparatus and stored at
80 °C. The amount of P450 in
intact E. coli and solutions was determined from the CO
minus the reduced difference spectrum (16), using a few grains of
sodium dithionite as the electron donor and an extinction coefficient
of 91 mM
1 cm
1 for the
absorbance difference at 450 minus 490 nm (19).
Purification of Mutant CYP2B4 from E. coli--
Mutant P450
proteins were purified as described for the wild-type P450, except for
mutants R122A, R126A, Y190A, and F115A which had a specific content of
less than 9 nmol/mg protein after the Reactive Red column. With these
mutants, an additional purification step was required. Combined
fractions from the Reactive Red columns were dialyzed overnight against
100 volumes of buffer C and loaded onto a DEAE-Sepharose Fast Flow
column (100 nmol of P450/ml of DEAE Sepharose), pre-equilibrated with
buffer C. The eluant containing the mutant P450s which did not bind to
the DEAE-Sepharose column was then loaded onto a Bio-Gel HTP
hydroxylapatite column, as described for the wild-type P450.
Purification of CYP2B4, Cyt b5, and P450 Reductase
from Rabbit Liver--
Liver microsomes were prepared from
phenobarbital-treated White New Zealand White rabbits (20). CYP2B4 was
purified from rabbit liver microsomes as described previously (21) and
had a specific content of 18 nmol of P450/mg of protein. NADPH P450 reductase was purified according to the method of Yasukochi and Masters
(22) from rabbit liver microsomes. The effective concentration of the
P450 reductase was calculated from its activity in the cytochrome
c assay (10, 23). It typically had a specific content of 48 nmol of P450 reductase/mg of protein. Cyt b5 was
purified from detergent-solubilized rabbit liver microsomes as
described previously (24) and had a specific content of 45-52 nmol of cyt b5/mg of protein. The concentration of cyt
b5 in crude preparations was determined by
measuring the difference spectrum (reduced minus oxidized) using an
extinction coefficient of 190 mM
1
cm
1 (424 minus 409 nm) (25). In purified preparations an
extinction coefficient of 117 mM
1
cm
1at 413 nm was used (26). Apocytochrome
b5 was generated by acetone precipitation in the
presence of HCl (27). Soluble cyt b5 was produced by treating cyt b5 with trypsin as
described previously (28).
Protein Analysis--
Protein concentration was determined using
the BCA assay (Pierce) or by the Lowry method (29) after precipitation
of the proteins in the presence of trichloroacetic acid and
deoxycholate (30). Bovine serum albumin was used as a standard.
SDS-polyacrylamide gels (9% for P450 and 15% for cyt
b5) were run as described (31). Immunoblot
analysis of CYP2B4 was performed as described (17), using Immobilon P
transfer membranes (Millipore Corp., Bedford, MA) and polyclonal goat
anti-rabbit CYP2B4 antibody at a 1:1000 dilution as the primary
antibody (Oxford Biomedical Research, Oxford, MI) and horseradish
peroxidase-linked sheep anti-goat antibody (Sigma) at a 1:1000 dilution
as the secondary antibody.
Determination of the Equilibrium Dissociation Constant
(Kd) of the Cyt b5-CYP2B4 Complex--
The binding
of cyt b5 to CYP2B4 was determined by measuring
the type I spectral change (decrease in absorbance at 420 nm plus the
increase in absorbance at 385 nm) occurring when cyt
b5 is added to a solution of P450,
methoxyflurane, and DLPC. Suspensions of DLPC in water (2-5 mg/ml)
were sonicated using a microtip probe on a Vibra Cell High Intensity
Ultrasonic processor (Sonics and Materials, Inc., Danbury, CT) for a
total of 2 min at 40% power in 30-s pulses, with 5 min cooling after
each pulse, and then centrifuged at 13,000 × g for 5 min. P450 (0.3 nmol) in 50 µl of 100 mM potassium
phosphate, pH 7.4, 20% glycerol, was mixed with DLPC (48 nmol) and
preincubated at room temperature for 1 h. The solution was then
adjusted to 1.0 ml using a solution of 100 mM
KPi, pH 7.4, and 20% glycerol which was saturated with methoxyflurane. The P450 solution was placed in one compartment of a
quartz dual chamber cuvette. The other chamber contained 1.0 ml of a
solution of cyt b5 (0.14 to 4.0 µM) in 100 mM KPi, pH 7.4, and
20% glycerol which was saturated with methoxyflurane. The solutions
were equilibrated to 25 °C, and the absorbance at 420 and 385 nm was
recorded. The solutions were then mixed by inverting the cuvette. After
mixing, the absorbance at 420 and 385 nm was followed until it
stabilized (typically 10-15 min). The absorbance changes resulting
from nonspecific protein binding to the cuvette were determined by
preparing solutions in two additional cuvettes containing buffer in one
chamber and either P450 or cyt b5 in the other
chamber. The absorbance change occurring on mixing in these cuvettes,
presumably due to nonspecific adsorption of the proteins to the walls
of the cuvettes, was determined at each protein concentration and
subtracted from the observed absorbance changes to obtain the change
resulting only from cyt 5 binding to P450. In preliminary experiments,
wild-type and mutant P450s (0.15 µM final concentration
after mixing with cyt b5) were assayed using at
least three different concentrations of cyt b5
within the range of 0.07 to 2.0 µM. The experimentally
observed absorbance changes ((A420 before
mixing
A420final)
(A385 before mixing
A385final)) were fitted to a theoretical binding
curve (as described under the "Appendix"), and the best fit between
the experimental and theoretical data was determined by nonlinear
regression. From the fitting procedure, estimates for the parameters
Kd and
Amax (the maximum
absorbance change) were obtained. Those mutants found to have similar
binding constants to wild-type P450 in the preliminary investigations
(F115A, Y190A, H226A, K276A, H335A, K421A, R422A, R443A, P472A, and
Y484A) were assayed two more times at a final concentration of 0.15 µM P450. The remaining mutants (R122A, R126A, R133A,
F135A, M137A, and K139A) were found in preliminary investigations to
have weaker binding constants than wild-type P450 and were analyzed in
more detail, using higher final concentrations of P450 (0.2 µM for R122A, 0.3 µM for H226A and K433A,
0.4 µM for K139A, and 0.4 and 0.5 µM for
R126A, R133A, F135A, and M137A). Final concentrations of cyt
b5 after mixing (0.25, 0.5, 1.0, 2.0, 3.0, 5.0, and 10.0 µM) were selected so that the observed
absorbance changes covered at least 50% of the theoretical range
(i.e.
Amax).
Determination of the Apparent Equilibrium Dissociation Constant
for the P450 Reductase-CYP2B4 Complex--
The apparent dissociation
constant of the P450 reductase-CYP2B4 complex was determined by
observing the rate of formaldehyde produced by the
N-demethylation of benzphetamine at a constant P450
concentration and varying concentrations of P450 reductase (32, 33).
The final wild-type and mutant P450 protein concentration was 0.2 µM, but the final concentration of P450 reductase varied (0.2, 0.3, 0.4, 0.5, 0.6, and 1.0 µM). Appropriate
concentrations of P450 and P450 reductase were preincubated with DLPC
(32 µM final concentration) in 50 mM
potassium phosphate, pH 7.4, for 1 h at room temperature. The
remainder of the reaction was performed as described for benzphetamine
metabolism. The equilibrium dissociation constant for each P450 protein
was calculated using nonlinear regression to fit the rate of
formaldehyde production to a theoretical binding curve (described under
the "Appendix"). From the fitting procedure, best fit estimates for
the parameters Kd (the apparent equilibrium
dissociation constant) and Vmax (the maximum rate of benzphetamine metabolism) were obtained.
Measurement of Benzphetamine Metabolism--
In order to measure
the rate of N-demethylation of benzphetamine to
formaldehyde, P450 (0.16 nmol) was mixed with P450 reductase (0.16 nmol) and DLPC (36 nmol) in 50 mM potassium phosphate
buffer, pH 7.4, and incubated for 1 h at room temperature. The
solution was then diluted to 0.8 ml with 50 mM potassium
phosphate buffer, pH 7.4, containing 1 mM benzphetamine
(final concentration of P450 and P450 reductase was 0.2 µM). Stock solutions of benzphetamine were 10 mM in water. The solution was equilibrated to 30 °C, and the reaction was initiated by the addition of NADPH (300 µM final concentration). 200-µl aliquots were removed
after 1 and 6 min incubation at 30 °C and quenched immediately with
22 µl of 70% trichloroacetic acid. The quenched reaction mixtures
were centrifuged at 13,000 × g for 5 min, and 200 µl
of supernatant was assayed for formaldehyde (34). The activity of each
mutant P450 protein was assayed in duplicate during four separate
experiments for the 5 min between min 1 and 6 of the reaction as
described previously (10).
Determination of the Kd of the Benzphetamine-CYP2B4
Complex--
The equilibrium dissociation constant for the
benzphetamine-CYP2B4 complex (the spectral binding constant
Ks) and its mutants was determined using a
spectrophotometric assay (35). P450 (0.72 nmol) was mixed with DLPC
(176 nmol) in 100 mM potassium phosphate buffer, pH 7.4, 20% glycerol and incubated for 1 h at room temperature. The
solution was diluted to 360 µl with 100 mM potassium
phosphate buffer, pH 7.4, to give a final P450 concentration of 2 µM and equilibrated to 30 °C. The spectrum of the
solution was recorded between 350 and 500 nm. Aliquots of a 10 mM benzphetamine hydrochloride solution were added, and the
spectrum was recorded after each addition of benzphetamine. Spectral
changes were complete within 1-2 min of addition of benzphetamine.
Final concentrations of benzphetamine were 10, 30, 100, 300, and 1000 µM. Spectra were corrected for dilution and difference
spectra were calculated at each concentration. A double-reciprocal plot
of benzphetamine concentration versus
(A420-A385) gave a
straight line, which was used to calculate the Kd
(Kd = slope/intercept with y axis).
Determination of Methoxyflurane Metabolism--
The products of
methoxyflurane metabolism (methoxydifluoroacetic acid and
dichloroacetic acid) were measured by a gas chromatographic-selected ion mass spectrometry assay, as described previously (10). The final
concentration of P450, P450 reductase, and cyt
b5 in the reaction mixture of the wild-type and
all mutant proteins was 0.2 µM. Experiments were
performed twice in duplicate with 0.5 ml of reaction mixture for 5 min.
Aliquots (200 µl) were removed after 1 and 6 min and were quenched
with 140 µl of 30% H2SO4. The amount of
methoxyflurane metabolism occurring between 1 and 6 min was recorded.
The internal standards containing
2H3-methoxydifluoroacetic acid and
2,2-[2-13C]dichloroacetic acid were added, and samples
were stored at
80 °C before extraction and analysis by mass
spectrometry. In addition, assays with the mutant proteins R122A,
R126A, R133A, F135A, M137A, K139A, R422A, K433A, and R443A were
performed twice in duplicate in a final volume of 2 ml (800 µl
aliquots were quenched after 1 and 11 min with 560 µl 30%
H2SO4) in order to obtain sufficient product to
measure by gas chromatography selected ion mass spectrometry.
Identification of the Interprotein Surface Docking Regions of
CYP2B4 and Cyt b5--
The method used to find surface
regions for binding is a surface complementarity algorithm for protein
docking (36, 37). The method, embodied in the program GRAMM, performs
an exhaustive search for protein-protein surface structure
complementarity. The three original contact regions obtained using this
method at low resolution (6.4-6.8 Å) have been described (1). In the studies reported here, this same method has been used for the CYP2B4-cyt b5 pair but at the higher resolution
of 3.4 Å. The results are more accurate than those from the previous
6.5-Å simulation but still can tolerate local inaccuracies in atomic
details. The 10 lowest energy docking positions were analyzed and the
results used to select preferred binding regions on CYP2B4 for cyt
b5.
 |
RESULTS AND DISCUSSION |
Optimization of the Expression of CYP2B4 and Its Mutants in E. coli--
Previous overexpression of mammalian P450s has been
achieved, using either derivatives of pCWOri+ (16) or the Amersham
Pharmacia Biotech vector pKK223-3 (38), both of which use a
tac promoter. CYP2B4 cDNA was initially cloned into both
of these vectors, but when expression was attempted, CYP2B4 protein
could not be identified in either Western blots of cell extracts or
spectrophotometrically. A T7 promoter containing vector,
pET-23d, was then selected for further expression attempts. Initially,
P450 was only observed on Western blots. However, reduction of the
temperature to 28 °C after induction with IPTG resulted in the
production of small amounts of holo-CYP2B4. To optimize the expression,
different host strains, concentrations of
-aminolevulinic acid,
incubation temperatures, and incubation times were systematically
tested. However, the maximum yield of holo-CYP2B4 obtained using this vector could not be increased above 200 nmol/liter. To increase the
yield, the low copy pBR322-derived origin of replication in pET-23d was
replaced with that from the high copy pBluescript II KS + vector (ColE1
origin of replication), to generate the expression vector pLW01 (Fig.
1). The level of holo-CYP2B4 expressed using this vector was increased
at least 2-fold over that obtained from pET-23d and reproducibly gave
400-600 nmol of holo-P450/liter. To achieve optimal expression, it was
necessary to grow the E. coli (both before and after
induction with IPTG) at room temperature. The addition of 0.5 mM
-aminolevulinic to the growth medium and extending
the length of the incubation after induction to 72 h both resulted
in an increase in CYP2B4 expression. Continuing expression beyond
72 h after induction did not result in a further increase in
holo-P450 expression.
In order to overexpress significant levels of a number of the P450s in
E. coli, it has frequently been necessary to mutate the N
terminus of the protein as first described by Waterman and co-workers
(16, 39, 40). In an attempt to optimize the expression of CYP2B4, two
mutants were constructed, one in which the Ala codon GGT (which
replaced a glutamic acid residue) was placed in second position and a
second mutant also with alanine in the second position E2A, and in
addition F3L, S4L, L6A, L7V mutations which produced the N-terminal
sequence of native bovine P450 17
-hydroxylase. Ala is the preferred
second codon for expression in E. coli (41). Expression of
these mutant proteins in JM109 E. coli using the pKK 223-3 vector with a tac promoter yielded no immunoreactive or
holoprotein, whereas expression using the pLW01 vector with a
T7 promoter yielded holo-P450 in quantities similar to
those obtained with the wild-type CYP2B4 construct. Therefore, the
wild-type CYP2B4 cDNA in vector pLW01 was used for all further
experiments.
Four additional plasmids were generated containing His tags. DNA
encoding 4, 6, and 10 consecutive His residues was cloned upstream of
the P450 DNA so that N-terminally tagged proteins would be produced.
Unfortunately, none of these His-tagged P450 genes expressed holo-P450,
although apoprotein could be identified. Expression of holo-CYP2B4 was
obtained from a plasmid encoding four adjacent His residues at the C
terminus of the CYP2B4 sequence; however, the wild-type construct
lacking the C-terminal His tag reproducibly expressed higher levels of
holo-P450, so subsequent experiments were performed without the His
tag.
To facilitate the generation of numerous P450 mutant proteins, four
silent mutations were introduced into the CYP2B4 sequence to create
unique restriction endonuclease sites, which divided the P450 sequence
into five 300-bp regions. Similar yields of native holo-P450 were
obtained with the wild-type gene (pLW-P450) and the P450 gene
containing the 4 silent mutations in pLW-P450-EKSX. pLW-P450-EKSX was,
therefore, used as the template for the construction of the mutants.
The level of expression of the wild-type and mutant P450s is summarized
in Table II.
View this table:
[in this window]
[in a new window]
|
Table II
Rationale for amino acid mutation and summary of the expression and
purification of wild-type and mutant cytochromes P450 2B4
|
|
Purification of Wild-type CYP2B4 and Its Mutants--
The
purification of P450 was achieved by a procedure that permits the
isolation of high specific content protein from the solubilized
"membrane fraction" in a single step using Reactive Red 120-agarose
affinity chromatography (Table III).
View this table:
[in this window]
[in a new window]
|
Table III
Summary of the purification of cytochrome P450 2B4
The experiments were performed as described under "Materials and
Methods."
|
|
The pelleted P450 containing the membrane fraction of E. coli was used as the starting point of the purification. A number of different detergents were tested for their ability to solubilize the
membrane pellet. The best results were obtained using
polyethoxyethylene 9 lauryl ether, which extracted approximately 90%
of the holo-CYP2B4. The first purification step after solubilization of
P450 from the E. coli membrane fraction has conventionally
involved DEAE-ion exchange chromatography (42-47). However, with
CYP2B4 only a small increase in specific content (e.g. from
1.0 to 2-3 nmol of P450/mg of protein) was achieved. The solubilized
CYP2B4 was, therefore, purified using Reactive Red 120-agarose affinity
chromatography. This single step resulted in extensive purification,
with the specific content typically increasing from 1.0 to 11.4 nmol of holo-P450/mg of protein. Since cyt P420 did not bind to the resin, this
column also separated cyt P420 from P450. The final step in the
procedure was a hydroxylapatite column to remove detergent, which also
resulted in a slight purification, yielding a specific content of 15.4 nmol of wild-type P450/mg of protein. Table III illustrates the overall
recovery (15%) and purification achieved at each step in the P450
isolation procedure. The spectrum of wild-type CYP2B4 purified from
E. coli is identical to that purified from rabbit liver
microsomes (20).
The purification of the majority of the mutant P450 proteins was
performed as described for wild-type CYP2B4. However, the F115A, R122A,
and R126A mutant P450s had specific contents of below 6.5 nmol of
P450/mg of protein after the Reactive Red affinity chromatography, so
an additional purification step using DEAE chromatography was
performed. This second column produced protein with a specific content
of 7.9-12.1 nmol of P450/mg of protein. The overall yield from the
cell culture (
10-15%) was not significantly affected by this
additional DEAE column. Sufficient quantities of the P450 mutant
proteins, F171A and R125A, could not be isolated due to their
instability during the purification procedure (90% was lost during
solubilization of the membrane fraction, Table II).
Rationale for the Mutation of Specific CYP2B4 Amino
Acids--
Table II lists the residues in CYP2B4 selected for
mutation, the rationale for their mutation, and their location in the
secondary structure of the model of CYP2B4. In an effort to simplify
the presentation of the data we may appear to discuss the model as though it were a crystal structure, although clearly the model is not a
crystal structure. It is simply a detailed hypothesis that has been
used to design and tentatively interpret the experiments described in
this article. All residues were mutated to the most common amino acid,
alanine, in order to evaluate the function of the amino acid side chain
distal to the
-carbon. The selection of these residues was guided by
computer docking studies of the heme domain of cyt
b5 and a model of CYP2B4 (1), and the
considerable amount of experimental evidence which indicated that the
redox partners of P450 would bind on its proximal face where the heme is closest to the surface (3, 13, 14). Column 2 of Table II also
tabulates the reason a specific mutant was constructed. The numbers in
column 2 of Table II correspond to the seven reasons provided in the
following paragraphs. The group A mutants in Table II correspond to
those that bind cyt b5 normally, and the group B
mutants are those that bind cyt b5 poorly. Group
C mutants produced holo-P450 in quantities inadequate for protein
characterization. Groups D and E mutants produced apoP450 or no P450,
respectively. The two group A mutants R422A and R443A that bind cyt
b5 normally but bind P450 reductase poorly are
indicated by a superscript b. Thus Table II summarizes and collates why
the mutants were constructed, which mutants were expressed, and which
mutants bound cyt b5 and P450 reductase poorly.
The detailed characterization of the mutant proteins is provided in
later sections of this report.
1. The five proximal region mutants R125A, R133A, M137A, R140A, and
R443A of CYP2B4, the five distal region mutants F171A, Y190A, H226A,
P472A, and Y484A, and the two side surface mutants F115A and F283A were
selected partly based on predictions from the computer simulations at
low and high resolution of complexes of CYP2B4 with cyt
b5. The x-ray structure of cyt
b5 and a model of CYP2B4 were used as input to
the program GRAMM (37) that uses a surface complementarity algorithm to
identify surface contact regions in the two protein partners of a
protein-protein complex. The results of a high resolution study at 3.4 Å indicated a strong preference for a proximal binding region and
eliminated the other two candidate regions on the distal and side
surface of CYP2B4 found at low resolution (6.4-8.6 Å). Specifically,
of the 10 lowest energy docked complexes obtained from GRAMM at 3.4 Å,
six of them formed a tight cluster at the proximal binding region of
CYP2B4. Such a cluster is a strong indication of the real binding site (37). The remaining four were spread randomly in different surface regions without forming clusters and were discounted as false positives. The residues of CYP2B4 found to be in close contact with
residues of cyt b5 in the three lowest energy
representative configurations of these six proximal region complexes
are shown in Fig. 4,
A-C, and Fig. 5
illustrates the surface location of the amino acids chosen for
mutation.

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 4.
Three possible binding sites on the proximal
surface of cytochrome P450 2B4 for cytochrome
b5. The predictions were made at 3.4-Å
resolution as discussed under "Experimental Procedures." The heme
and its cysteine ligand are shown in red.
|
|

View larger version (102K):
[in this window]
[in a new window]
|
Fig. 5.
Distal and proximal surfaces of cytochrome
P450 2B4. A, distal surface of CYP2B4 illustrating the
mutated amino acids. B, proximal surface of CYP2B4
illustrating the mutated amino acids. The heme and its cysteine ligand
are in red.
|
|
2. Arg-125, Lys-421, and Arg-443 on the proximal face were selected
because they are homologous to P450 camphor residues Arg-112, Lys-344,
and Arg-364 which had been predicted to form salt bridges with cyt
b5 and putidaredoxin (14). Arg-112 has also been
shown to be important in electron transfer (48).
3. Arg-126 was selected for mutation because it is homologous to
Arg-129 in cytochrome P450 2A5 (CYP2A5). In CYP2A5 (mouse P450coh)
mutation of R129 to serine decreased the ability of CYP2A5 to bind to
cyt b5-conjugated Sepharose 4B (49).
4. Ser-128 was chosen for mutation because cyt
b5 had been demonstrated to be a competitive
inhibitor of the phosphorylation of Ser-128 by
cAMP-dependent protein kinase (50).
5. Arg-122, Arg-125, Arg-126, Ser-128, Arg-133, Phe-135, Met-137,
Lys-139, and Arg-140 were chosen for mutation because of two previous
studies. In one study, it was suggested that cytochrome P450 2B1
(CYP2B1) residues 116-134 (residues 116-134 in CYP2B4) were involved
in binding cyt b5 because a synthetic peptide
composed of these CYP2B1 residues could inhibit the binding of cyt
b5 to CYP2B1 (51, 52). In the second study,
Davydov and co-workers (53) predicted that CYP2B4 residues 121-145
would be involved in binding cyt b5. This
prediction was based on their sequence alignment studies that indicated
that residues 68-87 of cyt c which are involved in cyt
b5 binding were homologous to CYP2B4 residues
121-145. Residues 125-139 constitute the C and C* helices (see Refs.
1 and 3 for secondary structure nomenclature) which are on the proximal
surface of CYP2B4 near the heme.
6. Arg-422, Lys-433, and Arg-434 were selected because they were basic
residues near the heme that previous investigators had suggested might
be involved in binding P450 reductase (54-56).
7. The basic residues, Lys-276 and His-335, were controls since they
are not predicted to be in any surface contact region or identified in
biochemical studies.
Location in the CYP2B4 Model of Groups C, D, and E
Mutants--
Four of the alanine mutants (S128A, R140A, F283A, and
R434A) did not express holo-P450 protein (Group D and E in Tables I and
IV). The location of the mutated residues
and the hydrogen bonding pattern of their side chains in the model was
studied in an attempt to gain insight into why the mutant proteins may not have expressed holoprotein (Table IV). Phe-283 is located on the
distal face of the model, in the loop before the I helix with no
obvious important structural role unless it stabilizes loop formation.
Ser-128, Arg-140, and R434A are all located on the proximal face of the
model. R140A, which does not express either holo- or apoprotein, is
located on a loop between the C* and D helices with its side chain
completely exposed on the molecular surface to water with no
discernable structural role.
The side chain hydroxyl of Ser-128 on the C helix is buried and forms a
hydrogen bond to the backbone carbonyl oxygen of Leu-124, the residue
immediately preceding the beginning of the C helix. This hydrogen bond
is possibly important for the structural stability of the protein.
However, mutation of the homologous residue Ser-129 to alanine or
glycine in murine P450 2E1 and expression of the mutant proteins in COS
cells resulted in holoprotein (57). A buried Ser-128 side chain is
consistent with the most recent studies of Schenkman and co-workers
(50) that indicate that Ser-128 in CYP2B1 can only be phosphorylated in
the apoprotein.
In our model, the guanidinium group of Arg-434 forms a salt bridge to
both oxygens of the heme D ring propionate and two hydrogen bonds to
the backbone carbonyls of Tyr-111 and Ile-114, respectively, via a
water molecule. The fifth possible hydrogen bond is formed with water.
ApoP450 production by the R434A mutant is consistent with its
hypothesized role in heme binding and stabilizing the protein structure
via hydrogen bonds to the carbonyl oxygens of two amino acids (1,
58).
The three mutants P472A, R125A, and F171A in group C in Tables II and
IV could be expressed but could not be purified in sufficient quantity
to characterize. The location of these mutated amino acids in the
CYP2B4 model and the possible result of mutating the amino acid on the
structure of CYP2B4 was examined in an attempt to understand why these
mutants might be unstable (see Table IV). One of the side chain
NH
groups of Arg-125 (aligns with P450 camphor Arg-112) forms a hydrogen
bond with the backbone carbonyl of Lys-433 and a buried water which, in
turn, forms a hydrogen bond to the heme D ring propionate. The
- and
second
NH are exposed on the surface to solvent. The alanine mutant
would be unable to form the hydrogen bonds with Lys-433 and the heme
and the shorter alanine side chain would likely produce a cavity on the
surface of the protein by which water could gain access to the heme and
thereby decrease the heme-protein binding. A similar phenomenon was
observed when Tyr-74 was mutated to lysine in cyt b5 (59). At present, the poor expression and
instability of P472A and F171A cannot be explained (Table II).
It is of interest that the remaining mutants gave rise to wild-type
levels of protein expression and stability even though many of the side
chains formed hydrogen bonds or salt bridges with other surface
residues. The hydrogen bonds formed by selected mutated side chains and
the possible structural consequences resulting from the mutations are
summarized in Table IV. The CYP2B4 model indicates that a large number
of basic amino acid residues is concentrated on the proximal surface of
the molecule near the heme. These basic residues presumably function to
neutralize the charge on the two buried heme propionate residues and
establish a molecular dipole which may facilitate catalysis, in
addition to being involved in redox partner binding (3).
Characterization of the Ability of Wild-type and Mutant P450s to
Bind Cyt b5--
Table V
lists the Kd values of the wild-type and mutant
P450s with cyt b5. The wild-type protein has a
Kd of
0.2 µM in good agreement with
a previously determined value of the Kd of the cyt
b5-CYP2B4 complex (35). Mutants Y190A, K276A,
H335A, K421A, R422A, R443A, and Y484A had a Kd of
0.2 µM similar to that of the wild-type protein and
served as negative controls. The Kd of His-226 was
0.45 µM and was considered to be indistinguishable from
wild type. The Kd could not be determined for the
F115A mutant protein because it precipitated in the cuvette. CYP2B4
residues K421A and R443A are homologous to cyt P450 camphor residues
Lys-344 and Arg-364 which had previously been hypothesized to be
involved in cyt b5 and putidaredoxin binding
(14, 60). The mutants R122A, R126A, R133A, F135A, M137A, K139A, and
K433A were observed in initial experiments to have a higher
Kd than wild-type proteins (Table V). Repeat
experiments using higher P450 (0.2-0.5 µM) and cyt
b5 concentrations (0.5-10 µM)
were conducted in an attempt to obtain more accurate estimates of the
Kd values by using protein concentrations that would
elicit at least 50% of the predicted
Amax.
The data obtained with R122A and R133A covered the middle to upper part
of the binding curve; the spectral changes with F135A and M137A plotted
to the middle of the binding curve, whereas the absorbance changes
observed with R133A and R126A only covered the lower part of the
binding curve even with a P450 concentration of 0.5 µM.
Therefore, the Kd values of R133A and R126A are the
most tentative. The
Amax for all mutants was
estimated from curve fitting and normalized to 0.15 µM
P450. Within experimental error (data not shown) the
Amax for all mutants was similar.
The seven amino acids that partially define the binding site on CYP2B4
for cyt b5 are all located on the proximal
surface near the heme ligand cysteine (Fig.
6A). All of the mutants except K433A are either located in the C or C* helices or in loops at the
termini of these helices. These results are in striking agreement with
the predictions by Davydov and co-workers (53) that CYP2B4 residues
121-145 would be involved in binding cyt b5.
The results also confirm the predictions of the surface complementarity
algorithm which was able to localize the binding site to the proximal
surface of CYP2B4 near the heme (37). However, the results do not
substantiate the prediction that Lys-421 and Arg-443 would be involved
in cyt b5 binding because of their homology to
residues Lys-344 and Arg-364 in P450 camphor which were hypothesized to
participate in cyt b5 binding (14).

View larger version (99K):
[in this window]
[in a new window]
|
Fig. 6.
The binding site on cytochrome P450 2B4 for
cytochrome b5 (A) and cytochrome
P450 reductase (B). Heme and its cysteine ligand are
in red.
|
|
Characterization of the Ability of Wild-type and Mutant P450s to
Metabolize the Substrates Methoxyflurane and Benzphetamine--
The
results obtained with the cyt b5 binding assay
indicate that seven of the mutant proteins have decreased ability to
bind cyt b5. If the active site and substrate
access channel have the same conformation as the wild-type protein, the
binding and metabolism of substrates which do not require cyt
b5 for their metabolism should be similar to
that observed for wild-type P450. In order to determine whether the
CYP2B4 mutant proteins functioned like wild type, three assays were
performed.
The Kd (Ks) between the
substrate, benzphetamine, and the mutant P450s was determined (see
Table V). Except for Y190A which binds benzphetamine tighter than the
wild-type protein, these results indicate that the
benzphetamine-binding site and substrate access channel of the mutants
are similar to that of the native protein.
The ability of the mutant proteins to catalyze the oxidation of
methoxyflurane was investigated. Methoxyflurane, whose metabolism is
markedly stimulated in the presence of cyt b5,
is a poor substrate for CYP2B4 (only 2% coupled) (10). The ability of
the mutant P450s to metabolize methoxyflurane both in the presence and
absence of cyt b5 was followed by measuring the
production of the metabolites, methoxydifluoroacetic acid, and
dichloroacetic acid. The results of these assays which were performed
at a P450 and cyt b5 concentration of 0.2 µM are shown in Table V. The ratio of methoxyflurane
metabolism in the presence and absence of cyt b5
is also given. The data indicate that mutants with reduced ability to
bind cyt b5 in the spectrophotometric assay are
stimulated to a lesser extent by cyt b5. An
exception to this is mutant K433A; although the rate of methoxyflurane
metabolism in the presence of cyt b5 is low, there is a 4-fold stimulation which cannot be explained. Note that
these experiments were performed at protein concentrations close to the
Kd of the P450-cyt b5
complex.
The ability of the mutants to metabolize the model substrate,
benzphetamine, is shown in Table V. The results were obtained from
experiments where P450 and P450 reductase were both present at a final
concentration of 0.16 µM. All of the P450 mutants except M137A, with diminished ability to bind cyt b5
and mutants R422A and R443A, have a 50-85% reduced rate of
benzphetamine metabolism compared with wild type (determined by
t test analysis). If the mutants with a normal ability to
bind cyt b5 are compared as a group to the
mutants showing a reduced ability to bind cyt
b5, it can be demonstrated that the mutants with
the diminished ability to bind cyt b5 have a
significantly lower rate of benzphetamine metabolism than the mutants
with normal cyt b5 binding. This finding prompted us to examine the ability of these mutants to bind P450 reductase.
Characterization of the Ability of Wild-type and Mutant P450s to
Bind P450 Reductase--
A number of previous investigators have
identified basic residues on the proximal surface of CYP2B4 which were
presumed to participate in binding acidic residues on P450 reductase.
Strobel and co-workers (55, 56) demonstrated that when eight lysine residues in CYP2B1, which is 85% identical to CYP2B4, were chemically modified by acetic anhydride, 95% of the activity was lost. Residues that were modified in this inactive protein and their predicted location in the secondary structure of P450 are Lys-384 (
1-3; side
chain hydrogen bond to carboxyl of Asp-374 in
2-1), Arg-422 (m-
), Lys-433 (
bulge), and Arg-473 (substrate recognition site 6). These residues correspond to the same residues in CYP2B4. (See
Table IV for location of the residues in the secondary structure of
P450, as well as the hydrogen bonding pattern of the Arg-422 and
Lys-433 side chains.) Fujii-Kuriyama and co-workers (54) mutated the
conserved lysine residues in cytochrome P450 1A2 (P450d) by
site-directed mutagenesis and showed that several had a decreased ability (2-4-fold) to bind and be reduced by P450 reductase. Some of
these residues are predicted to be on the proximal surface of CYP2B4
and correspond to residues Arg-422, Lys-433, and Arg-443 in CYP2B4
which were mutated in the experiments described here. Cyt P450scc (CYP
11A1), a mitochrondrial P450, was also mutated at residues Arg-377 and
Arg-381 which are predicted to be located in the K helix and correspond
to CYP2B4 residues Asp-350 and His-354 (61). Arg-377 and Arg-381 were
shown to play crucial roles in binding adrenodoxin. Thus, the consensus
of a large body of experimental evidence is that basic residues on the
proximal surface of P450 are involved in binding acidic residues on a
redox partner. Until recently, our understanding of the result of such
mutagenesis studies has been hindered by the unavailability of reliable
models of microsomal P450s.
The P450-catalyzed oxidation of substrates requires the transfer of two
electrons from P450 reductase. Electron transfer occurs within a
transient intermolecular complex between P450 and P450 reductase (33).
If complex formation between electron donor and acceptor molecules did
not occur, efficient electron transfer would be impossible and
electrons would be dissipated into the medium. It has been assumed that
the rate of substrate oxidation is proportional to the concentration of
the P450-P450 reductase complex, which is an approach similar to that
used by Miwa et al. (33). The observation that oxyferrous
cytochrome P450 accumulates during turnover (62, 63) supports this
assumption, since it indicates that product formation is limited by
electron transfer. This relationship can be described by Equation 1.
|
(Eq. 1)
|
where rate refers to the rate of substrate oxidation, k
is a proportionality constant, and [P450-P450 reductase] is the
concentration of the interprotein complex. A general equation that
relates the equilibrium dissociation constant of the P450-P450
reductase complex and the rate of substrate oxidation was derived (see
"Appendix") and has been used to determine the
Kd, equilibrium dissociation constant, of the
P450-P450 reductase complex. The rate of oxidation of the substrate,
benzphetamine, was measured experimentally in the presence of varying
but known concentrations of P450 and P450 reductase. These data were
fit to Equation 21 under the "Appendix," and the
Kd values between the individual mutant P450s and
the reductase were calculated using nonlinear regression.
The apparent Kd for the wild-type CYP2B4-P450
reductase complex is 0.02 ± 0.02 µM, in agreement
with previously published values (33). Consistent with the
determination of the Kd values of the individual
complexes was the finding that substrate oxidation was proportional to
reductase concentration with a fixed concentration of P450. As
predicted the weaker binding P450 mutants exhibited a greater
percentage increase in product formation with a given increment of the
reductase. In the absence of P450 the control reactions exhibited no
substrate oxidation. Nine mutant P450s exhibited an increased apparent
Kd in complex with P450 reductase (Table V). The
seven mutants, R122A, F135A, M137A, K139A, K433A, R126A, and R133A,
that bound cyt b5 poorly also bound reductase
poorly. In addition, the mutants R422A and R443A showed elevated
Kd values. The binding of these nine mutant P450s to
P450 reductase was diminished 6-47-fold (Table V). The location of the
mutated amino acids on the surface of CYP2B4 that exhibited diminished
binding to reductase is shown in Fig. 6B. As mentioned
previously, six of the mutants with decreased ability to bind cyt
b5 are located on the proximal surface of CYP2B4
slightly below the heme in the C and C* helices. The location of the
other amino acids in the secondary structure of the CYP2B4 model and
their possible role in its structural stability follows. Lys-433 is in
the highly conserved
-bulge three residues away from the heme
ligand, cysteine 436. A nitrogen in its side chain forms a salt bridge
with the carboxyl group of Asp-90 in the B helix; the remainder of the
guanidinium group is exposed to solvent. R422A is in a loop in a
conserved region between the meander and the
-bulge above the heme.
One of the nitrogens in its side chain guanidinium group forms a salt
bridge with the side chain carboxyl of Glu-424 also in the conserved
region between the meander and
-bulge. The remainder of the Arg-422
guanidinium group is on the surface exposed to water. Arg-443 is in the
L helix, and its side chain forms a salt bridge with the side chain
carboxyl group of Glu-439 also in the L helix. Arg-443 is homologous to
the P450 camphor residue, Arg-364, which forms a structurally important salt bridge to Glu-286 in the K helix (64) and was predicted to form a
salt bridge with P450 camphor's redox partners, cyt b5 and putidaredoxin (14). Table IV lists the
hydrogen bonding pattern of the mutated amino acid side chains and the
expected structural effects of mutating the amino acid to an alanine.
In many instances, structural perturbations are expected, and cavities are created which will give water access to previously shielded surfaces. Our results unexpectedly reveal that the binding sites for
cyt b5 and P450 reductase have considerable
overlap. These results are not in agreement with previous experiments
with a purified, covalently cross-linked, functional CYP2B4-cyt
b5 complex (65). The previous studies indicated
that there was no overlap between the cyt b5 and
P450 reductase-binding site on CYP2B4. At present, there is no
explanation for the discrepancy.
Note that the initial assays for methoxyflurane and benzphetamine
metabolism were conducted at total P450 reductase concentrations of 0.2 µM and 0.16 µM, respectively. The reductase
concentrations are 8- and 6.4-fold higher than the
Kd of the P450-P450 reductase complex. The presence
of these relatively high concentrations of reductase during the assays
of substrate metabolism presumably accounts for the fact that substrate
metabolism was only minimally disturbed in those mutants exhibiting
decreased ability to bind both P450 reductase and cyt
b5.
Although the predicted Vmax values for
benzphetamine metabolism had a large standard deviation, they were all
indistinguishable from the wild-type protein, except for the R126A
mutant with a
66% decreased Vmax (Table IV),
indicating that in the presence of elevated levels of P450 reductase
the mutant P450s function normally.
Characterization of the Free Energy of Binding between the Mutant
P450s and Their Redox Partners--
The specific interactions between
CYP2B4 and its redox partners cyt b5 and P450
reductase are critical events during substrate oxidation in
vitro and in vivo. In this article, seven cyt P450 residues that participate in the cyt b5-P450
interaction and nine cyt P450 residues that participate in the P450
reductase-P450 interaction have been identified, partially on the basis
of the complementarity of the surfaces of cyt b5
and a CYP2B4 model. In an effort to more thoroughly understand the
function of the mutated amino acids in the protein-protein association,
the difference in the free energy of binding between the wild-type and
mutant P450s and cyt b5 was calculated (Table
V). The free energy of binding (calculated using the formula
G = RTlnKd) between cyt b5 and wild-type CYP2B4 is
9.2 kcal/mol.
Of the seven mutant proteins with decreased ability to bind cyt
b5, the R133A mutant protein had the greatest
reduction in affinity (>2.2 kcal/mol). The sum of the difference in
free energy of binding between the seven mutant P450s and cyt
b5 is
10.8 kcal/mol, which exceeds the known
binding free energy for the entire complex by 1.6 kcal/mol (Table V)
(66, 67).
Modeling of the effects of deleting the hydrophobic side chains,
hydrogen bonds, and salt bridges, formed by the mutated side chains in
CYP2B4, indicates that the mutations are likely to lead to local
structural and electrostatic perturbations that would contribute to the
decrease in the binding of the mutant P450s to cyt
b5 (Tables IV and V). At least one of the
hydrogens of the basic side chains of Arg-122, Arg-133, Lys-139, and
Lys-433 interact with an oppositely charged residue in the CYP2B4 model and is likely to generate a local structural change when mutated.
Mutation of basic residues on the proximal surface of CYP2B4 may also
disrupt the molecular dipole which has been suggested to function
pre-collisionally, both to orient the interaction of P450 with its
redox partners and to promote the electrochemical flow of the reactants
involved in oxidation (3). The molecular dipole of P450 is oriented so
that it will promote the proximal-to-distal flow of electrons from the
redox partner and the distal-to-proximal flow of protons from the
solvent.
Previous studies of the cyt b5-cyt c and the
growth hormone-growth hormone receptor interprotein-binding sites
indicate that their surfaces are complementary and that a few
hydrophobic residues near the center of the interprotein-binding site
provide the majority of the binding energy. These core residues were
surrounded by less energetically important, more