Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katoh, H.
Right arrow Articles by Negishi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katoh, H.
Right arrow Articles by Negishi, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 5, 2489-2492, January 30, 1998

COMMUNICATION
p160 RhoA-binding Kinase ROKalpha Induces Neurite Retraction*

Hironori Katoh, Junko Aoki, Atsushi Ichikawa, and Manabu NegishiDagger §

From the Department of Physiological Chemistry and the Dagger  Department of Molecular Neurobiology, Faculty of Pharmaceutical Sciences, Kyoto University, Sakyo-ku, Kyoto 606, Japan

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References

We previously reported that the activation of prostaglandin E receptor EP3 subtype caused neurite retraction via small GTPase Rho in the EP3B receptor-expressing PC12 cells (Katoh, H., Negishi, M., and Ichikawa, A. (1996) J. Biol. Chem. 271, 29780-29784). However, a potential downstream effector of Rho that induces neurite retraction was not identified. Here we examined the morphological effect of p160 RhoA-binding kinase ROKalpha , a target for RhoA recently identified, on the nerve growth factor-differentiated PC12 cells. Microinjection of the catalytic domain of ROKalpha rapidly induced neurite retraction similar to that induced by microinjection of a constitutively active Rho, RhoV14, whereas microinjection of the kinase-deficient catalytic domain of ROKalpha did not induce neurite retraction. This morphological change was observed even though C3 exoenzyme, which was known to inactivate Rho, had been preinjected. On the other hand, microinjection of the Rho-binding domain or the pleckstrin homology domain of ROKalpha inhibited the EP3 receptor-induced neurite retraction. These results demonstrate that ROKalpha induces neurite retraction acting downstream of Rho in neuronal cells.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Rho, a member of the Ras superfamily of small GTPases, is implicated in various cellular morphological functions, such as formation of stress fibers and focal adhesion (1), cell motility (2), cytokinesis (3), cell aggregation (4), and smooth muscle contraction (5). When cells are activated by extracellular stimuli, inactive GDP-bound Rho is converted to active GTP-bound Rho. Once activated, Rho probably interacts with its specific targets, leading to a variety of biological functions (6). Recently, several target proteins that interact only with GTP-bound Rho have been identified, including p128 protein kinase N (7, 8), p160 RhoA-binding kinase ROKalpha (9) also known as its bovine counterpart Rho-kinase (10) or its mouse counterpart ROCK-II (11), rhophilin (7), rhotekin (12), and p140mDia (13). Among them, ROKalpha has been reported to be involved in several functions of Rho: the regulation of myosin phosphorylation (14, 15), the formation of stress fibers and focal adhesions (16, 17), and probably the regulation of cytokinesis (18).

Rho has also been implicated in the control of neuronal cell morphologies. The activation of a certain heterotrimeric GTP-binding protein (G-protein)-coupled receptor,1 such as lysophosphatidic acid and thrombin receptors, caused the rapid retraction of extended neurites in several neuronal cell lines (19-21). Clostridium botulinum C3 exoenzyme, which specifically ADP-ribosylates Rho and suppresses the actions of Rho (22, 23), inhibits the receptor-mediated neurite retraction (24, 25), indicating that Rho activity is required for this morphological change. Although this effect appears to be induced by the contractility of the actin-based cytoskeleton (24, 26), a downstream effector of Rho that induces neurite retraction has not yet been identified.

We previously reported that the activation of prostaglandin EP3 receptor caused Rho-dependent neurite retraction in the NGF-differentiated PC12 cells expressing the EP3B receptor (27), one of the EP3 receptor isoforms isolated from bovine adrenal medulla (28). In non-neuronal cells, the activation of EP3 receptor stimulates the Rho-mediated formation of stress fibers (29), indicating that EP3 receptor is a potent activator of Rho in various cell types. In this report, we have examined the putative role of ROKalpha in the EP3 receptor-mediated neurite retraction in the NGF-differentiated PC12 cells. We show that ROKalpha is involved in the EP3 receptor-mediated neurite retraction and that the activation of ROKalpha is sufficient for inducing neurite retraction.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Materials-- M&B28767 was a generous gift from Dr. M. P. L. Caton of Rhone-Poulene Ltd. NGF 2.5S was purchased from Promega Corporation, and C. botulinum C3 exoenzyme was from Seikagaku Kogyo (Tokyo, Japan). The sources of the other materials are shown in the text.

Expression and Purification of Recombinant Proteins-- The coding region of human RhoA was generated by reverse transcription-polymerase chain reaction (PCR) from HeLa cells using primers 5'-CTGGACTCGAATTCGTTGCCTGAGCAATGG-3' and 5'-GCAAGATGAATTCTGATTTGTAATCTTAGG-3'. The PCR product was digested with EcoRI, cloned into the pBluescript KS(+), and completely sequenced. cDNAs for RhoAV14 and RhoAV14A37 were generated by PCR-mediated mutagenesis (30), subcloned into the BamHI/EcoRI sites of pGEX-4T-2 vector, and sequenced. Recombinant RhoAV14 and RhoAV14A37 were expressed as glutathione S-transferase (GST) fusion proteins in Escherichia coli, and purified on glutathione-Sepharose beads according to the method of Self and Hall (31). The sequence encoding ROKalpha containing the catalytic domain (CD-ROKalpha , amino acids 1-543), the Rho-binding domain (RBD-ROKalpha , amino acids 932-1065), and the pleckstrin homology (PH) domain (PHD-ROKalpha , amino acids 1116-1379) were generated by reverse transcription-PCR from PC12 cells, using primers 5'-ATGAGCGGATCCCCGCCGACGGGGAAA-3' and 5'-ACCTTCTGAATTCATATCTGAGAGCTCTGG-3' for CD-ROKalpha , 5'-GACGGATCCAAAGAGAAGATCATGAAAGAGC-3' and 5'-GTTGTGTGAATTCTTAACGTTCAG-3' for RBD-ROKalpha , and 5'-TCGCAGGGATCCGCCTTGCATATTGG-3' and 5'TCTTGTGGATGGAAGAATTCGATCACCTTC3' for PHD-ROKalpha , respectively. The kinase-deficient mutant of CD-ROKalpha (CD-ROKalpha K112G) was generated by PCR-mediated mutagenesis. All PCR products for each domain of ROKalpha were cloned into the pCR2.1 vector and sequenced completely. The PCR products for RBD-ROKalpha and PHD-ROKalpha were subcloned into the BamHI/EcoRI sites of pGEX-4T-2 vector, and recombinant proteins were expressed as GST fusion proteins in E. coli and purified on glutathione-Sepharose beads. The PCR products for CD-ROKalpha and CD-ROKalpha K112G were subcloned into the BamHI/EcoRI sites of pAcG2T vector, and recombinant proteins were expressed as GST fusion proteins in Sf9 cells with BaculoGoldTM system (PharMingen) and purified on glutathione-Sepharose beads according to the method of Matsui et al. (10). All recombinant proteins were dialyzed with an injection buffer (10 mM Tris-HCl, pH 7.6, 150 mM NaCl, 2 mM MgCl2, and 0.1 mM dithiothreitol) at 4 °C overnight for microinjection. Protein concentration was determined by comparing with bovine serum albumin standards after electrophoresis on a SDS-polyacrylamide gel and staining with Coomassie Brilliant Blue.

Cell Culture and Microinjection-- The EP3B receptor-expressing PC12 cells (27) were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 5% horse serum, 4 mM glutamine, 100 units/ml penicillin, and 0.2 mg/ml streptomycin under humidified conditions in 95% air and 5% CO2 at 37 °C. For microinjection, cells were seeded on poly-D-lysine-coated (Sigma) 35-mm dishes, which were marked with a cross to facilitate the localization of injected cells. After the cells had been differentiated in serum-free Dulbecco's modified Eagle's medium containing 50 ng/ml NGF and 20 µM indomethacin for 3 days, microinjection was performed using an IMM-188 microinjection apparatus (Narishige, Tokyo, Japan). During microinjection, the differentiated cells were maintained in Hepes-buffered Dulbecco's modified Eagle's medium, pH 7.4, at 37 °C. Cells were photographed at × 200 magnification under a phase contrast microscope. For the quantitative examination shown in Fig. 3, neurite-retracted cells were defined as the cells that retracted by more than 10% of their original length within 30 min of the addition of the agonist or of the microinjection of recombinant proteins. The percentages of neurite-retracted cells were calculated by counting at least 30 cells in the same field. Data were obtained from triplicate experiments.

    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

In our previous study, we obtained evidence that M&B28767, an EP3 agonist, induced neurite retraction in the EP3B receptor-expressing PC12 cells and that this morphological change was completely inhibited when the cells were microinjected with C3 exoenzyme, which ADP-ribosylates and inactivates Rho (22, 23), indicating that the EP3B receptor induced neurite retraction through the activation of Rho (27). To determine whether activation of Rho is sufficient for inducing neurite retraction in the PC12 cells, we microinjected a constitutively activated recombinant RhoA, RhoAV14 into the NGF-differentiated PC12 cells and examined its effect. As shown in Fig. 1 (C and D), microinjection of RhoV14 into the cytoplasm caused retraction of the neurites within 30 min. More than 70% of the injected cells retracted their neurites (Fig. 3). This morphological change was similar to that stimulated by M&B28767 (Fig. 1, A and B). The neurite-retracted cells by microinjection of RhoAV14 was not stained with trypan blue (data not shown), indicating that they did not undergo cell death. On the other hand, RhoAV14 containing a T37A substitution in the effector region, RhoAV14A37, had no effect on the differentiated cells after microinjection (Fig. 1, E and F, and Fig. 3), suggesting that this mutation blocked the interaction of Rho with its target to induce neurite retraction. This result also indicated that there were not any nonspecific effects due to the microinjection itself.


View larger version (128K):
[in this window]
[in a new window]
 
Fig. 1.   Neurite retraction induced by M&B28767 or microinjection of RhoAV14. A and B, M&B28767-induced neurite retraction. The cells were differentiated with NGF for 3 days and photographed before (A) and 30 min after (B) addition of 1 µM M&B28767. C and D, microinjection of RhoAV14. The cells were differentiated with NGF for 3 days and photographed before (C) and 30 min after (D) microinjection of 1 mg/ml of RhoAV14. E and F, microinjection of RhoAV14A37. The cells were differentiated with NGF for 3 days and photographed before (C) and 30 min after (D) microinjection of 1 mg/ml of RhoAV14A37. The arrows indicate injected cells. The results shown are representative of three independent experiments. The bar represents 50 µm.

Previous studies suggested that the generation of actin-based contractile forces was required for neurite retraction (24, 26). Among several targets of Rho, ROKalpha appears to participate in Rho-dependent contractile events, such as the formation of stress fibers (16, 17) and the regulation of cytokinesis (18). By Northern blot analysis, ROKalpha was expressed in the NGF-differentiated PC12 cells (data not shown). Therefore, we examined whether ROKalpha was involved in the Rho-mediated neurite retraction in the NGF-differentiated PC12 cells. ROKalpha contains the catalytic domain in its amino terminus, the coiled-coil domain, the Rho-binding domain, and the PH domain in its carboxyl terminus (9). It was recently shown that the truncation mutant of ROKalpha containing the catalytic domain displayed constitutive kinase activity without the addition of active form of Rho, whereas the Rho-binding domain and the PH domain of ROKalpha served as dominant negative forms of the kinase (16, 17). Based on these characters, we generated recombinant proteins containing these domains: the catalytic domain of ROKalpha (CD-ROKalpha , amino acids 1-543), the kinase-deficient mutant of CD-ROKalpha (CD-ROKalpha K112G), the Rho-binding domain of ROKalpha (RBD-ROKalpha , amino acids 932-1065), and the PH domain of ROKalpha (PHD-ROKalpha , amino acids 1116-1379). To examine the effects of these domains of ROKalpha on neurite retraction, we microinjected these recombinant proteins into the NGF-differentiated cells and analyzed their morphologies.

After the cells had been microinjected with CD-ROKalpha , they rapidly retracted their neurites within 30 min (Fig. 2, A and B, and Fig. 3). This morphological change was similar to that induced by microinjection of RhoAV14. The neurite-retracted cells by microinjection of CD-ROKalpha was not stained with trypan blue (data not shown), indicating that they did not undergo cell death. On the other hand, microinjection of the kinase-deficient mutant of CD-ROKalpha mutant CD-ROKalpha K112G had no effect (Fig. 2, C and D, and Fig. 3), indicating that the kinase activity of CD-ROKalpha was required for inducing neurite retraction. When the cells were microinjected with C3 exoenzyme, the M&B28767-induced neurite retraction was completely inhibited (Fig. 2, E and F). However, the CD-ROKalpha -induced neurite retraction was not inhibited after the cells had been microinjected with C3 exoenzyme (Fig. 2, G and H), indicating that CD-ROKalpha acted downstream of Rho.


View larger version (112K):
[in this window]
[in a new window]
 
Fig. 2.   Neurite retraction induced by ROKalpha . A and B, microinjection of CD-ROKalpha . The cells were differentiated with NGF for 3 days and photographed before (A) and 30 min after (B) microinjection of 2 mg/ml of CD-ROKalpha . C and D, microinjection of CD-ROKalpha K112G. The cells were differentiated with NGF for 3 days and photographed before (C) and 30 min after (D) microinjection of 2 mg/ml of CD-ROKalpha K112G. E and F, the effect of C3 exoenzyme on the M&B28767-induced neurite retraction. After the NGF-differentiated cells microinjected with 100 µg/ml of C3 exoenzyme had been preincubated for 30 min, they were photographed before (E) and 30 min after (F) addition of 1 µM M&B28767. G and H, the effect of C3 exoenzyme on the CD-ROKalpha -induced neurite retraction. After the NGF-differentiated cells microinjected with 100 µg/ml of C3 exoenzyme had been preincubated for 30 min, they were photographed before (G) and 30 min after (H) microinjection of 2 mg/ml of CD-ROKalpha . The arrows indicate injected cells. The results shown are representative of three independent experiments. The bar represents 50 µm.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3.   Quantification of effects of M&B28767, Rho, and ROKalpha on neurite retraction. After the cells had been differentiated with NGF for 3 days, they were exposed to 1 µM M&B28767 or microinjected with the recombinant proteins of the indicated mutants of Rho or ROKalpha . The percentages of neurite-retracted cells were determined 30 min after the addition of the agonist or the microinjection of the proteins, as described under "Experimental Procedures." RhoV14 or RhoV14A37 was injected at 1 mg/ml, and CD-ROKalpha or CD-ROKalpha K112G was injected at 2 mg/ml. Data are the means ± S.E. of triplicate experiments.

Next we microinjected RBD-ROKalpha or PHD-ROKalpha , which served as dominant negative forms of ROKalpha , into the differentiated cells and examined each effect on the M&B28767-induced neurite retraction. When the cells had been microinjected with RBD-ROKalpha or PHD-ROKalpha , the M&B28767-induced neurite retraction was inhibited (Fig. 4). All the cells microinjected with RBD-ROKalpha or PHD-ROKalpha had no response to M&B28767. These results suggest that ROKalpha is involved in the EP3 receptor-mediated neurite retraction in the PC12 cells. Taken together, our results suggest that ROKalpha induces neurite retraction acting downstream of Rho in the NGF-differentiated PC12 cells.


View larger version (119K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of the Rho-binding domain and the PH domain of ROKalpha on M&B28767-induced neurite retraction. The NGF-differentiated cells were microinjected with 2 mg/ml of RBD-ROKalpha (A and B) or 1 mg/ml of PHD-ROKalpha (C and D) and photographed before (A and C) and 30 min after (B and D) addition of 1 µM M&B28767. The arrows indicate injected cells. The results shown are representative of three independent experiments. At least 20 cells were microinjected in each experiment, and all cells microinjected gave the described response. The bar represents 50 µm.

Recently, ROKalpha was shown to be involved in Rho-induced formation of stress fibers and focal adhesion in other cell types such as fibroblasts. However, the organization of stress fibers induced by constitutively active ROKalpha was apparently different from that induced by lysophosphatidic acid or constitutively active Rho (16, 17), suggesting that additional signals were required for Rho-induced stress fiber formation. In this study, however, microinjection of CD-ROKalpha sufficiently induced neurite retraction similar to that induced by RhoV14 even though C3 exoenzyme had been preinjected, whereas CD-ROKalpha K112G failed to induce neurite retraction (Figs. 2 and 3), suggesting that the increase in the kinase activity of ROKalpha by Rho appears to be sufficient for inducing neurite retraction. Because myosin-binding subunits of myosin phosphatase and myosin light chain are known to be substrates for ROKalpha and activation of ROKalpha leads to phosphorylation and activation of myosin (14, 15), neurite retraction may be induced by ROKalpha -mediated regulation of myosin phosphorylation. In addition, it was recently reported that glial fibrillary acidic protein, an intermediate filament protein expressed in the cytoplasm of astroglia, was identified as another substrate for ROKalpha (18). Therefore, we will consider substrate(s) of this kinase for neurite retraction in future studies. Until now, we have obtained evidence that the activation of EP3B receptor, coupling to Rho activation, did not affect the NGF-induced mitogen-activated protein kinase activation in the PC12 cells (data not shown), suggesting that the activation of Rho or ROKalpha did not inhibit the NGF-induced signaling to the Ras-mitogen-activated protein kinase pathway. To examine the direct effect of Rho or ROKalpha on the NGF-induced differentiation, we are currently establishing PC12 cell lines that express RhoAV14 or CD-ROKalpha under the control of an inducible promoter.

As shown in Fig. 4, two fragments of ROKalpha , the Rho-binding domain and the PH domain, served as dominant negative forms of ROKalpha in the EP3 receptor-mediated neurite retraction, as reported for the formation of stress fibers and focal adhesion (16, 17). ROKalpha has been shown to be translocated to peripheral membranes upon transfection with RhoV14 (9). Because PH domains are supposed to play a key role in localization of molecules to the specific target regions in the membranes, the PH domain of ROKalpha may localize this kinase at the specified region in response to the EP3 receptor-induced activation of Rho, and this translocation of ROKalpha to its target region seems to be essential for inducing neurite retraction. On the other hand, RBD-ROKalpha may block the interaction between endogenous Rho and ROKalpha . We also showed that RhoAV14A37, a mutant at the effector region, lost the ability to induce neurite retraction in the differentiated PC12 cells (Fig. 1, E and F, and Fig. 3). Indeed, RhoAV14 bound to the RBD-ROKalpha , but RhoAV14A37 did not (data not shown). This defect in binding to ROKalpha seems to be the reason for the inability of RhoAV14A37 to induce neurite retraction.

In conclusion, we have here shown that ROKalpha is an essential component of Rho-mediated neurite retraction in neuronal cells. Considering that ROKalpha is enriched in the brain (16), ROKalpha may play a critical role in the regulation of neuronal cell morphology in the brain. However, many questions have not yet been elucidated in this field, for example how the G-protein coupled receptor activates Rho. Further investigations are necessary to understand Rho-mediated signal transduction in neuronal cells.

    FOOTNOTES

* This work was supported in part by Grants-in-aid for Scientific Research 09273105, 09259219, and 09307052 from the Ministry of Education, Science, and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed. Tel.: 81-75-753-4547; Fax: 81-75-753-4557; E-mail: mnegishi{at}pharm.kyoto-u.ac.jp.

1 The abbreviations used are: G-protein, GTP-binding protein; PCR, polymerase chain reaction; GST, glutathione S-transferase; PH, pleckstrin homology; PHD, PH domain; NGF, nerve growth factor; CD, catalytic domain; RBD, Rho-binding domain.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

  1. Ridley, A. J., and Hall, A. (1992) Cell 70, 389-399[CrossRef][Medline] [Order article via Infotrieve]
  2. Takaishi, K., Sasaki, T., Kato, M., Yamochi, W., Kuroda, S., Nakamura, T., Takeichi, M., and Takai, Y. (1994) Oncogene 9, 273-279[Medline] [Order article via Infotrieve]
  3. Kishi, K., Sasaki, T., Kuroda, S., Itoh, T., and Takai, Y. (1993) J. Cell. Biol. 120, 1187-1195[Abstract/Free Full Text]
  4. Tominaga, T., Sugie, K., Hirata, M., Morii, N., Fukata, J., Uchida, A., Imura, H., and Narumiya, S. (1993) J. Cell Biol. 120, 1529-1537[Abstract/Free Full Text]
  5. Hirata, K., Kikuchi, A., Sasaki, T., Kuroda, S., Kaibuchi, K., Matsuura, Y., Seki, H., Saida, K., and Takai, Y. (1992) J. Biol. Chem. 267, 8719-8722[Abstract/Free Full Text]
  6. Machesky, L. M., and Hall, A. (1996) Trends Cell Biol. 6, 304-310 [CrossRef][Medline] [Order article via Infotrieve]
  7. Watanabe, G., Saito, Y., Madaule, P., Ishizaki, T., Fujisawa, K., Morii, N., Mukai, H., Ono, Y., Kakizuka, A., and Narumiya, S. (1996) Science 271, 645-648[Abstract]
  8. Amano, M., Mukai, H., Ono, Y., Chihara, K., Matsui, T., Hamajima, Y., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) Science 271, 648-650[Abstract]
  9. Leung, T., Manser, E., Tan, L., and Lim, L. (1995) J. Biol. Chem. 270, 29051-29054[Abstract/Free Full Text]
  10. Matsui, T., Amano, M., Yamamoto, T., Chihara, K., Nakafuku, M., Ito, M., Nakano, T., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) EMBO J. 15, 2208-2216[Medline] [Order article via Infotrieve]
  11. Nakagawa, O., Fujisawa, K., Ishizaki, T., Saito, Y., Nakao, K., and Narumiya, S. (1996) FEBS Lett. 392, 189-193[CrossRef][Medline] [Order article via Infotrieve]
  12. Reid, T., Furuyashiki, T., Ishizaki, T., Watanabe, G., Watanabe, N., Fujisawa, K., Morii, N., Madaule, P., and Narumiya, S. (1996) J. Biol. Chem. 271, 13556-13560[Abstract/Free Full Text]
  13. Watanabe, N., Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A., Saito, Y., Nakao, K., Jockusch, B., M., Narumiya, S. (1997) EMBO J. 16, 3044-3056[CrossRef][Medline] [Order article via Infotrieve]
  14. Kimura, K., Ito, M., Amano, M., Chihara, K., Fukuta, Y., Nakafuku, M., Yamamori, B., Feng, J., Nakano, T., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) Science 273, 245-248[Abstract]
  15. Amano, M., Ito, M., Kimura, K., Fukuta, Y., Chihara, K., Nakano, T., Matsuura, Y., and Kaibuchi, K. (1996) J. Biol. Chem. 271, 20246-20249[Abstract/Free Full Text]
  16. Leung, T., Chen, X.-Q., Manser, E., and Lim, L. (1996) Mol. Cell. Biol. 16, 5313-5327[Abstract]
  17. Amano, M., Chihara, K., Kimura, K., Fukuta, Y., Nakamura, N., Matsuura, Y., and Kaibuchi, K. (1997) Science 275, 1308-1311[Abstract/Free Full Text]
  18. Kosako, H., Amano, M., Yanagida, M., Tanebe, K., Nishi, Y., Kaibuchi, K., and Inagaki, M. (1997) J. Biol. Chem. 272, 10333-10336[Abstract/Free Full Text]
  19. Suidan, H. S., Stone, S. R., Hemmings, B. A., Monard, D. (1992) Neuron 8, 363-375[CrossRef][Medline] [Order article via Infotrieve]
  20. Jalink, K., and Moolenaar, W. H. (1992) J. Cell Biol. 118, 411-419[Abstract/Free Full Text]
  21. Tigyi, G., and Miledi, R. (1992) J. Biol. Chem. 267, 21360-21367[Abstract/Free Full Text]
  22. Aktories, K., Weller, U., and Chhatwal, G. S. (1987) FEBS Lett. 212, 109-113[CrossRef][Medline] [Order article via Infotrieve]
  23. Sekine, A., Fujiwara, M., and Narumiya, S. (1989) J. Biol. Chem. 264, 8602-8605[Abstract/Free Full Text]
  24. Jalink, K., Coven, E. J., Hengeveld, T., Morii, N., Narumiya, S., and Moolenaar, W. H. (1994) J. Cell Biol. 126, 801-810[Abstract/Free Full Text]
  25. Tigyi, G., Fischer, D. J., Sebök, A., Yang, C., Dyer, D. L., Miledi, R. (1996) J. Neurochem. 66, 537-548[Medline] [Order article via Infotrieve]
  26. Jalink, K., Eichholtz, T., Postma, F. R., Coven, E. J., Moolenaar, W. H. (1993) Cell Growth Differ. 4, 247-255[Abstract]
  27. Katoh, H., Negishi, M., and Ichikawa, A. (1996) J. Biol. Chem. 271, 29780-29784[Abstract/Free Full Text]
  28. Namba, T., Sugimoto, Y., Negishi, M., Irie, A., Ushikubi, F., Kakizuka, A., Ito, S., Ichikawa, A., and Narumiya, S. (1993) Nature 365, 166-170[CrossRef][Medline] [Order article via Infotrieve]
  29. Hasegawa, H., Negishi, M., Katoh, H., and Ichikawa, A. (1997) Biochem. Biophys. Res. Commun. 234, 631-636[CrossRef][Medline] [Order article via Infotrieve]
  30. Ito, W., Ishiguro, H., and Kurosawa, Y. (1991) Gene (Amst.) 102, 67-70[CrossRef][Medline] [Order article via Infotrieve]
  31. Self, A. J., and Hall, A. (1995) Methods Enzymol. 256, 3-10[Medline] [Order article via Infotrieve]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
I. M. Macias-Perez, R. Zent, M. Carmosino, M. D. Breyer, R. M. Breyer, and A. Pozzi
Mouse EP3 {alpha}, {beta}, and {gamma} Receptor Variants Reduce Tumor Cell Proliferation and Tumorigenesis in Vivo
J. Biol. Chem., May 2, 2008; 283(18): 12538 - 12545.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
A. Schmandke, A. Schmandke, and S. M. Strittmatter
ROCK and Rho: Biochemistry and Neuronal Functions of Rho-Associated Protein Kinases
Neuroscientist, October 1, 2007; 13(5): 454 - 469.
[Abstract] [PDF]


Home page
J. Cell Sci.Home page
G. Berto, P. Camera, C. Fusco, S. Imarisio, C. Ambrogio, R. Chiarle, L. Silengo, and F. Di Cunto
The Down syndrome critical region protein TTC3 inhibits neuronal differentiation via RhoA and Citron kinase
J. Cell Sci., June 1, 2007; 120(11): 1859 - 1867.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
P. Sun, H. Watanabe, K. Takano, T. Yokoyama, J.-i. Fujisawa, and T. Endo
Sustained activation of M-Ras induced by nerve growth factor is essential for neuronal differentiation of PC12 cells.
Genes Cells, September 1, 2006; 11(9): 1097 - 1113.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Mimura, S. Yamagishi, N. Arimura, M. Fujitani, T. Kubo, K. Kaibuchi, and T. Yamashita
Myelin-associated Glycoprotein Inhibits Microtubule Assembly by a Rho-kinase-dependent Mechanism
J. Biol. Chem., June 9, 2006; 281(23): 15970 - 15979.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Longhurst, M. Watanabe, J. D. Rothstein, and M. Jackson
Interaction of PDZRhoGEF with Microtubule-associated Protein 1 Light Chains: LINK BETWEEN MICROTUBULES, ACTIN CYTOSKELETON, AND NEURONAL POLARITY
J. Biol. Chem., April 28, 2006; 281(17): 12030 - 12040.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Lambrechts, V. Jonckheere, C. Peleman, D. Polet, W. De Vos, J. Vandekerckhove, and C. Ampe
Profilin-I-ligand interactions influence various aspects of neuronal differentiation
J. Cell Sci., April 15, 2006; 119(8): 1570 - 1578.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Tanaka, H. Katoh, and M. Negishi
Pragmin, a Novel Effector of Rnd2 GTPase, Stimulates RhoA Activity
J. Biol. Chem., April 14, 2006; 281(15): 10355 - 10364.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
E.-E. Govek, S. E. Newey, and L. Van Aelst
The role of the Rho GTPases in neuronal development
Genes & Dev., January 1, 2005; 19(1): 1 - 49.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. B. Jones, H. Y. Lu, and Q. Lu
Abl Tyrosine Kinase Promotes Dendrogenesis by Inducing Actin Cytoskeletal Rearrangements in Cooperation with Rho Family Small GTPases in Hippocampal Neurons
J. Neurosci., September 29, 2004; 24(39): 8510 - 8521.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kakimoto, H. Katoh, and M. Negishi
Identification of Splicing Variants of Rapostlin, a Novel Rnd2 Effector that Interacts with Neural Wiskott-Aldrich Syndrome Protein and Induces Neurite Branching
J. Biol. Chem., April 2, 2004; 279(14): 14104 - 14110.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. R. Wylie and P. D. Chantler
Myosin IIA Drives Neurite Retraction
Mol. Biol. Cell, November 1, 2003; 14(11): 4654 - 4666.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. C. Bornhauser, P.-A. Olsson, and D. Lindholm
MSAP Is a Novel MIR-interacting Protein That Enhances Neurite Outgrowth and Increases Myosin Regulatory Light Chain
J. Biol. Chem., September 12, 2003; 278(37): 35412 - 35420.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Abe, M. Kato, H. Miki, T. Takenawa, and T. Endo
Small GTPase Tc10 and its homologue RhoT induce N-WASP-mediated long process formation and neurite outgrowth
J. Cell Sci., January 1, 2003; 116(1): 155 - 168.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Tominaga, W. Meng, K. Togashi, H. Urano, and M. Tominaga
The Rho GTPase Effector Protein, mDia, Inhibits the DNA Binding Ability of the Transcription Factor Pax6 and Changes the Pattern of Neurite Extension in Cerebellar Granule Cells through Its Binding to Pax6
J. Biol. Chem., November 27, 2002; 277(49): 47686 - 47691.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Fujita, H. Katoh, Y. Ishikawa, K. Mori, and M. Negishi
Rapostlin Is a Novel Effector of Rnd2 GTPase Inducing Neurite Branching
J. Biol. Chem., November 15, 2002; 277(47): 45428 - 45434.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
G. Gallo, H. F. Yee Jr., and P. C. Letourneau
Actin turnover is required to prevent axon retraction driven by endogenous actomyosin contractility
J. Cell Biol., September 29, 2002; 158(7): 1219 - 1228.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Nusser, E. Gosmanova, Y. Zheng, and G. Tigyi
Nerve Growth Factor Signals through TrkA, Phosphatidylinositol 3-Kinase, and Rac1 to Inactivate RhoA during the Initiation of Neuronal Differentiation of PC12 Cells
J. Biol. Chem., September 20, 2002; 277(39): 35840 - 35846.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
P. Dergham, B. Ellezam, C. Essagian, H. Avedissian, W. D. Lubell, and L. McKerracher
Rho Signaling Pathway Targeted to Promote Spinal Cord Repair
J. Neurosci., August 1, 2002; 22(15): 6570 - 6577.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Yamazaki, H. Miyazaki, H. Watanabe, T. Sasaki, T. Maehama, M. A. Frohman, and Y. Kanaho
Phosphatidylinositol 4-Phosphate 5-Kinase Is Essential for ROCK-mediated Neurite Remodeling
J. Biol. Chem., May 3, 2002; 277(19): 17226 - 17230.
[Abstract] [Full Text] [PDF]


<