|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 276, Issue 7, 5204-5212, February 16, 2001
From the Medical Molecular Biology Unit, Institute of Child Health,
University College London, 30 Guilford Street,
London WC1N 1EH, United Kingdom
Received for publication, August 4, 2000, and in revised form, October 23, 2000
Inactivation of the gene encoding the POU domain
transcription factor BRN-3A results in the absence of specific neurons
in knockout mice. Here we demonstrate for the first time a direct effect of BRN-3A on the survival of neuronal cells. Specifically, overexpression of BRN-3A in cultured trigeminal ganglion or dorsal root
ganglion sensory neurons enhanced their survival following the
withdrawal of nerve growth factor. Moreover, reduction of BRN-3A levels
impaired the survival of these neurons. The survival of sympathetic
neurons was not affected by either approach. Similarly, overexpression
of BRN-3A activated the endogenous Bcl-2 gene in trigeminal
neurons, but not in sympathetic neurons. The protective effect of
BRN-3A on trigeminal neuron survival following nerve growth factor
withdrawal significantly increased during embryonic development. In
contrast, overexpression of the related factor BRN-3B enhanced survival
of trigeminal neurons only at an early stage of embryonic development.
Thus, BRN-3A (and in some circumstances, BRN-3B) can promote the
survival of nerve growth factor-dependent sensory but not
sympathetic neurons, allowing it to play a direct role in the survival
of some (but not all) neuronal populations in the developing and adult
nervous systems.
The BRN-3 transcription factors are members of the POU family of
transcription factors, which was originally defined on the basis of a
common 150-160-amino acid DNA-binding domain found in the mammalian
transcription factors Pit-1, Oct-1, and
Oct-2 and the nematode regulatory protein Unc-86
(for review, see Refs. 1 and 2). All the original founder members of
the POU family are expressed in neuronal cells, with Pit-1
playing a key role in the development of the pituitary gland (3),
whereas Unc-86 is essential for the development of specific
neuronal cell types, particularly sensory neurons in the nematode (4,
5).
Three BRN-3 factors have been defined in mammalian cells, where they
constitute the most closely related mammalian factors to
Unc-86, with each factor being encoded by a distinct gene
(6). The three BRN-3 factors are BRN-3A (also known as BRN-3 or
BRN-3.0) (7-9), BRN-3B (also known as BRN-3.2) (9, 11), and BRN-3C (also known as BRN-3.1) (7, 12). These three closely related factors
are expressed in distinct but overlapping groups of neurons in the
developing and adult nervous systems (7-9, 11, 12), with BRN-3A, for
example, defining the earliest post-mitotic neurons to appear in the
developing central nervous system (13).
The expression patterns of Brn-3a, Brn-3b, and
Brn-3c, as well as their relationship to Unc-86,
suggest that they may play key roles in the development of specific
neuronal cell types in mammals. In agreement with this, inactivation of
the gene encoding BRN-3C in knockout mice results in defective inner
ear cell function due to the failure to produce sensory hair cells
(14), and mutation in the human gene encoding BRN-3C has recently been
reported to be the cause of progressive deafness in an Israeli family
(15). Similarly, inactivation of the gene encoding BRN-3B results in the loss of ~70% of retinal ganglion cells, with little effect on
other neurons (14, 16).
In contrast to the relatively organ-specific effects of inactivation of
Brn-3b or Brn-3c, inactivation of BRN-3A causes widespread losses of
specific populations of motor neurons and of proprioreceptive, mechanoreceptive, and nociceptive sensory neurons. This results in mice
with uncoordinated limb movement and impaired suckling that die shortly
after birth (17, 18). This widespread role for BRN-3A is paralleled by
its ability to activate the expression of a number of different genes
expressed in neuronal cells such as those encoding pro-opiomelanocortin
(7), SNAP-25 (19), Interestingly, the losses of neuronal cells in Brn-3a
knockout mice have previously been suggested to be due to a loss of expression of specific neurotrophic factors or their receptors (17). In
turn, this would evidently disrupt neurotrophin signaling, resulting in
a loss of their survival-promoting effects and consequently leading to
the observed neuronal cell death. However, no direct effect of BRN-3A
on the promoters of genes encoding neurotrophins or their receptors has
been reported. We have recently reported that BRN-3A overexpression can
activate the promoter of the Bcl-2 proto-oncogene ~50-fold
in cotransfection assays (22, 23). Similarly, BRN-3A overexpression
results in ~15-fold overexpression of BCL-2 protein derived from the
endogenous Bcl-2 gene in a transfected neuronal cell line
(22, 23). These findings raise the possibility that BRN-3A may have a
direct effect on the survival of neuronal cells. We have therefore
investigated the effect of increasing or decreasing the levels of
BRN-3A in specific neuronal cell types on their survival in the
presence or absence of neurotrophins.
Plasmid Constructs--
Full-length Brn-3a and
Brn-3b cDNA expression vectors have been described
elsewhere (22, 23). The BRN-3A-specific antisense construct was
generated by polymerase chain reaction
(PCR)1 using primers
GGATCCGCTGCAGAGCAACCTCTTC and
GTCGACGAGCGACGGCGACGAGATC, where boldface and underlined
sequences indicate BamHI and SalI restriction
enzyme recognition sites, respectively. The 240-base pair PCR product
was ligated into the pGEM-T vector (Promega) and subcloned as a
BamHI/SalI fragment into the mammalian expression vector pJ7.
Culture of Primary Neurons--
Dorsal root, trigeminal, and
superior cervical ganglia were dissected from newborn Harlan
Sprague-Dawley rat pups at postnatal day 1 or from staged C57 mouse
embryos, where the day of finding the vaginal plug was designated
embryonic day (E) 0.5. Following dissection, ganglia were incubated for
between 5 and 15 min at 37 °C with 0.05% trypsin (Worthington; in
calcium- and magnesium-free Hanks' balanced salt solution). The
precise period of incubation in trypsin was dependent on the age of the
ganglia. After removal of trypsin, ganglia were washed twice with 10 ml
of Ham's F-12 medium containing 10% heat-inactivated horse
serum and were gently triturated with a fire-polished,
siliconized Pasteur pipette to give a single cell suspension. Neurons
were then purified from non-neuronal cells using a metrizamide density
gradient, modified from the purification strategy devised by Camu and
Henderson (24). Metrizamide (Sigma M 4512) volumetrically prepared at
6% (w/v) in growth medium without bovine serum albumin was
sterile-filtered and equilibrated in an incubator prior to use.
Dissociated cells were gently layered with a metrizamide cushion and
then centrifuged at 145 × g (900 rpm) for 5 min at
room temperature. Neurons were collected into a pellet, whereas the
non-neuronal cells (~95%) remained in the supernatant. The
supernatant was decanted, and the pelleted cells were washed with
complete growth medium and spun again at 145 × g for 5 min.
Neurons were cultured as described (25, 26). The purified neurons were
plated at a density of 500-1000 neurons in a 50-µl droplet on a
13-mm coverslip in a 24-well plate. Coverslips were precoated with
poly-DL-ornithine (0.5 mg/ml overnight) and laminin (20 µg/ml overnight). The cells were then left between 5 h and overnight to adhere and flooded with growth medium. The neurons were
incubated at 37.5 °C in a humidified 3.5% CO2 incubator
in a defined medium consisting of Ham's F-14 medium supplemented with
2 mM glutamine, 0.35% bovine serum albumin
(Pathocyte-4, ICN), 60 ng/ml progesterone, 16 µg/ml
putrescine, 400 ng/ml L-thyroxine, 38 ng/ml sodium
selenite, 340 ng/ml triiodothyronine, 60 mg/ml penicillin, and 100 mg/ml streptomycin. Neurons were recognized by their bipolar morphology
under phase-contrast optics (25, 26).
Prior to transfection, cells were cultured for 24 h in medium
supplemented with recombinant nerve growth factor (NGF; Life Technologies, Inc.) at a final concentration of 20 ng/ml. In control experiments, this 24-h incubation was sufficient to select for NGF-dependent neurons. Thus, the resulting cultures showed
no enhanced survival when other neurotrophic factors were added
together with NGF compared with adding NGF alone. The following day, 1 µg of pCi expression vector containing the murine long form of Brn-3a cloned downstream of the constitutive
cytomegalovirus (CMV) gene promoter (pCi3A) was introduced into
cultured cells by liposome-mediated transfection. Control cultures were
similarly transfected with 1 µg of empty pCi expression vector
(referred to as pCi).
Liposome transfection was carried out exactly as described by McQuillin
et al. (27). Briefly,
3
Transfected cells were incubated for 24 h following transfection,
and the medium was then replaced with fresh medium with or without the
addition of NGF. To determine efficiency of transfection and to
identify individual transfected neurons, cultures were cotransfected
with 1 µl of plasmid encoding the lacZ gene under the
control of the CMV promoter (CMV-lacZ). Survival of
transfected cells (as visualized by Virus Construction and Growth--
The full-length
Brn-3a cDNA was cloned downstream of the Rous sarcoma
virus promoter and in reverse orientation to the cDNA encoding
green fluorescent protein (GFP) cloned under the control of the CMV
promoter. This expression cassette (pR20.5-Brn-3a) was
subcloned into a shuttle vector so that it was flanked by herpes
simplex virus-1 UL43 gene sequences. The
pR20.5-Brn-3a-UL43 shuttle vector was
cotransfected into baby hamster kidney cells together with herpes
simplex virus-1 strain 1764 DNA, which contains an inactivating
insertion in the Vmw65 gene as well as deletion of both
copies of the ICP34.5 gene (28). Recombinant virus was subsequently plaque-purified on the basis of the visualization of GFP
under ultraviolet conditions. Western blot analysis was performed to
confirm that high levels of BRN-3A protein were produced in infected
cultures before a high titer stock was grown. Control virus containing
the bacterial lacZ gene under the control of the Rous
sarcoma virus promoter (i.e. containing
pR20.5-lacZ-UL43) was similarly generated.
Trigeminal ganglion neurons were isolated and maintained in cultures as
described above on glass coverslips at a density of ~200
neurons/coverslip. Cultures were infected in duplicate with ~1 × 105 plaque-forming units of BRN-3A or control
virus/coverslip for 60 min, washed, and then maintained in medium
supplemented with NGF for 24 h. Efficiency of viral infection was
determined by visualization of GFP before the medium was replaced with
fresh medium with or without the addition of NGF. Neuronal cell counts were then performed 24 h later.
TUNEL Procedure--
Cells were fixed with 4% paraformaldehyde
for 15 min at room temperature and then washed twice with
phosphate-buffered saline. Terminal transferase reaction solution (10 units of terminal transferase and 2 mM fluorescein
isothiocyanate-labeled dUTP (Roche Molecular Biochemicals) in
buffer containing 200 mM potassium cacodylate, 25 mM Tris-HCl, 2.5 mM bovine serum albumin, and
2.5 mM cobalt chloride, pH 6.6) was added for 2 h at
37 °C. Cells were then washed twice with phosphate-buffered saline
and viewed under a fluorescence microscope. The number of apoptotic
nuclei was counted and expressed as a percentage of total nuclei.
Reverse Transcription-PCR Assay--
The reverse
transcription-PCR assay was carried out as described previously using
conditions that have been shown to generate a linear relationship
between the input mRNA and the signal obtained (22, 25, 29-32).
The primers for the total Brn-3a mRNA (amplifying both
endogenous mRNA and exogenous mRNA from the transfected
plasmid) (see Fig. 3) were forward primer 5'-CGGGGTTGTACGGCAAAA3-' and reverse primer 5'-GTGGGCTCGGCGCTGGCC3-'. Primers to specifically amplify the exogenous Brn-3a mRNA (see Fig. 7) consisted
of a forward primer derived from the 5'-untranslated region of the expression vector (5'-TCTCGAACTTAAGCTGCAGT-3') and a reverse primer from within the Brn-3a mRNA
(5'-TGAGGCTGCTTGCTGTTCAT-3'). This combination ensured
amplification of only the exogenous Brn-3a mRNA derived
from the transfected expression vector, producing a 380-base pair product.
The primers for the endogenous control
glyceraldehyde-6-phosphate dehydrogenase mRNA were
5'-GTTCGACAGTTGATTGGAGC-3' and 5'-CACCTCAACAGCCACATGAA-3', which
produce a 200-base pair product. The primers for the endogenous Bcl-2 mRNA were 5'-AGAATCACAGGACTTCTGCA-3' and
5'-GCTTGAATGCACTTGAAGTA-3', which produce a 430-base pair product.
Annexin V Labeling--
Cells were fixed in 4% paraformaldehyde
for 20 min, washed three times with phosphate-buffered saline, and then
placed in annexin buffer (10 mM Hepes, pH 7.4, 140 mM NaCl, and 2.5 mM CaCl2). 10 µl
of annexin V-phycoerythrin (30 µg/ml; R&D Systems) was added per
milliliter of annexin buffer and incubated on the cells at room
temperature for 10 min. The buffer was removed and replaced with
phosphate-buffered saline. Annexin-positive cells were identified under
a fluorescence microscope.
Statistics--
Single factor ANOVA was used to analyze
differences for each group of treatments, with differences among means
within each group of treatments being compared using Student's
t test. Significance was taken as a p < 0.05. To protect against inflation of error rate as a result of
multiple comparisons, the Bonferroni method was applied manually to the
results of the ANOVA tests. In Bonferroni's test, to achieve
significance, each comparison must show significance well beyond the
0.05 (95% confidence) level. The level of significance required is
determined by the following equation: C = k!/(2!(k BRN-3A has previously been shown to be expressed at high levels in
trigeminal ganglion neurons (7, 25), and significant losses of such
neurons are observed in Brn-3a knockout mice, with the size
of the ganglion at E20 being approximately half that in wild-type or
heterozygous mice and the dorsal division of the anteromedial lobe of
the ganglion being completely absent at postnatal day 0.5 (17, 18). We
therefore investigated the effect of overexpressing BRN-3A on the
ability of these neurons to survive both in the presence and absence of
NGF, whose removal results in the death of significant numbers of
neurons by programmed cell death or apoptosis.
Trigeminal ganglion neurons obtained from rat pups at postnatal day 1 were separated from non-neuronal cells on a metrizamide density
gradient. The resulting cultures contained >95% neurons on the basis
of their typical bipolar morphology and extensive neurites after 2 days
in culture. The phase-contrast images of the cultures are very similar
to those reported previously using this method (33, 34). In addition,
we also confirmed the identity of these cells by their positive
staining for Parallel samples of neurons were transfected with either empty
expression vector lacking any insert or the same expression vector
containing full-length cDNA for Brn-3a cloned downstream of the constitutive cytomegalovirus gene promoter. Each transfection also included a Moreover, a clear enhancement of survival in the cells transfected with
Brn-3a was observed compared with those transfected with
vector even in the presence of NGF (Fig.
4A). In the absence of NGF,
this difference became even larger, with almost 3-fold the number of
surviving neurons being observed in the cultures transfected with
Brn-3a compared with the control cultures transfected with
vector alone (p < 0.05 in Student's t test
when survival in the absence of NGF of cells transfected with vector
versus Brn-3a is compared and p < 0.0001 in a single ANOVA test; Bonferroni's test confirmed
significance at 95% confidence, p < 0.0084). Hence, BRN-3A overexpression can protect trigeminal neurons from cell death
both in the presence and absence of NGF.
Interestingly, this protective effect was paralleled by enhanced expression of the endogenous Bcl-2 gene in the cells transfected with Brn-3a (Fig. 3). These findings represent the first demonstration that BRN-3A can induce expression of the endogenous Bcl-2 gene in primary neuronal cells (as opposed to a neuronal cell line) and suggest that Brn-3a may mediate its effect on neuronal survival, at least in part, via activation of Bcl-2. Similar results were also observed in experiments carried out using postnatal dorsal root ganglion neurons, which also express BRN-3A (7, 10) and are lost in the knockout mice (17, 18). Thus, as shown in Fig. 4B, enhanced survival was observed for the Brn-3a-transfected DRG neurons both in the presence and absence of NGF, although the effect was less dramatic than in the case of the trigeminal neurons, possibly because more DRG neurons survive in the absence of NGF (p < 0.0005 in a single ANOVA test). These data thus indicate that BRN-3A overexpression can enhance the survival of both trigeminal and DRG neurons in the presence and absence of a specific neurotrophic factor. To determine whether endogenous BRN-3A expression also plays a role in the survival of these neurons, we utilized an antisense approach. Thus, we generated a specific antisense construct in which a 240-base pair region derived from the N terminus of BRN-3A that cannot cross-hybridize to either Brn-3b or Brn-3c was expressed in an antisense orientation under the control of the CMV promoter. We have previously used a similar approach to successfully reduce the level of BRN-3A in an immortalized neuronal cell line (19). This construct was introduced into trigeminal and DRG neurons by liposome-mediated transfection as described above. As expected, reduced expression of endogenous BRN-3A was observed in the cells transfected with the antisense construct (Fig. 3). In these experiments, both trigeminal (Fig. 4A) and DRG (Fig. 4B) neurons showed significantly reduced survival when transfected with the Brn-3a antisense construct compared with the transfection with empty expression vector. This reduced survival was observed both in the presence and absence of NGF, indicating that expression of BRN-3A is important for survival under both these conditions (p < 0.001 for trigeminal neurons and p < 0.01 for DRG neurons when survival of cells transfected with vector is compared with that of cells transfected with the Brn-3a antisense plasmid in Student's t test; Bonferroni's test confirmed significance at 95% confidence, p < 0.0084). Interestingly, in this case, the higher survival of DRG neurons in the absence of NGF was paralleled by a greater reduction in their survival when transfected with the Brn-3a antisense construct (p < 0.0001 for trigeminal neurons and p < 0.0005 for DRG neurons in a single ANOVA test) (Fig. 4, compare A and B). Interestingly, the level of endogenous Bcl-2 expression was reduced in the cells transfected with the antisense construct (Fig. 3). This indicates that the endogenous expression of Bcl-2 in sensory neurons is dependent upon Brn-3a and that the effect of reduced BRN-3A expression on neuronal survival may be mediated, at least partly, via reduced BCL-2 expression. To investigate the nature of the death processes in neurons in which
BRN-3A expression has been manipulated, we used TUNEL labeling to
monitor apoptotic death in DRG neurons in which BRN-3A expression had
been increased or decreased. As illustrated in Fig.
5, BRN-3A overexpression dramatically
reduced the number of TUNEL-labeled cells when NGF was withdrawn.
Similarly, reduced BRN-3A levels produced enhanced apoptosis even in
the presence of NGF (p < 0.0001 in a single ANOVA
test).
To confirm the protective effect of BRN-3A against apoptotic death, we used annexin V surface staining of the transfected cells, which measures the translocation of phosphatidylserine to the outer surface of the cell membrane, which occurs early in apoptotic cell death and is distinct from the later DNA degradation, which is measured by TUNEL labeling. As indicated in Table I, cells transfected with BRN-3A showed a greatly reduced proportion of annexin V-positive cells compared with cells transfected with expression vector alone, and this was statistically significant (p < 0.0005 in Student's t test and p < 0.0001 in a single ANOVA test; Bonferroni's test confirmed significance at 99% confidence, p < 0.017). Hence, BRN-3A appears to exert its effects on neuronal survival by modulating the extent of apoptotic cell death.
Although our data suggest that endogenous BRN-3A plays a key role in the survival of trigeminal and DRG neurons both in the presence and absence of NGF, it was evidently also possible that the effect of the antisense construct was due to some nonspecific toxic effect of this construct. We therefore tested the effect of introducing this construct into cultured sympathetic neurons derived from the superior cervical ganglia. Thus, these neurons do not express endogenous BRN-3A (25) and should not therefore be affected by antisense Brn-3a. In these experiments (Fig. 6), no
statistically significant difference in survival was observed for the
SCG neurons in the presence of NGF, whether they were transfected with
vector or the antisense construct. Similarly, extensive cell death was
noted in the absence of NGF in both the cells transfected with the
vector control and those transfected with the Brn-3a
antisense construct, and there was no statistically significant
difference between the two groups. Hence, the effect of the
Brn-3a antisense construct is indeed specific to neurons
that express BRN-3A, rather than representing a nonspecific toxic
effect of this construct.
In these experiments, we also investigated the effect of introducing a
Brn-3a expression vector into the SCG neurons. Most interestingly, the extensive cell death that was observed in these neurons upon NGF withdrawal was not reduced in any way in the cells
transfected with the Brn-3a expression vector compared with those transfected with expression vector lacking any insert or the
Brn-3a antisense construct, with no statistically
significant difference in survival being observed in the three groups
(Fig. 6). To confirm that BRN-3A was expressed from the plasmid vector in SCG as well as trigeminal ganglion neurons, we used primers that
will amplify only the exogenous Brn-3a mRNA derived from the expression vector in a reverse transcription-PCR assay. BRN-3A expression from the transfected construct was readily detectable in the
SCG cells transfected with the Brn-3a expression vector, indicating that this effect was not due to a failure of the construct to express BRN-3A in this neuronal cell type (Fig.
7A). These findings indicate
that the ability of overexpressed BRN-3A to protect neuronal cells from
cell death upon neurotrophic factor withdrawal is neuronal cell
type-specific, with trigeminal and DRG neurons being protected, whereas
SCG neurons are not protected by the overexpression of BRN-3A.
Interestingly, in previous experiments (22, 23), we have shown that BRN-3A can activate Bcl-2 promoter constructs in cotransfections carried out in DRG neurons or the ND7 neuronal cell line, but not in baby hamster kidney fibroblast cells. We therefore tested whether overexpression of BRN-3A in SCG neurons was able to enhance the expression of the endogenous Bcl-2 gene. As shown in Fig. 7B, no increase in Bcl-2 expression was observed in the SCG cells overexpressing BRN-3A. In contrast, overexpression of BRN-3A in trigeminal ganglion neurons clearly resulted in overexpression of Bcl-2 (Fig. 7C) in accordance with our previous results (Fig. 3). Hence, the ability of BRN-3A to protect trigeminal neurons from apoptosis is associated with its ability to induce Bcl-2 expression, whereas this does not occur in SCG neurons. To extend these studies, we wished to investigate the ability of BRN-3A to protect trigeminal ganglion neurons at different stages of development. To do this, we initially utilized trigeminal cultures from E17 embryos as opposed to the postnatal cultures we had previously used. To efficiently introduce the Brn-3a gene into these cultures, we prepared a disabled herpes simplex virus vector expressing both BRN-3A and GFP. This vector lacks functional viral genes encoding the Vmw65 transactivator protein and the ICP34.5 neurovirulence factor, and we have previously shown that it is able to effectively deliver genes to neuronal cells both in vitro and in vivo without causing significant neuronal cell death (28). The E17 cultures were therefore infected with this virus or with
control virus expressing only a reporter gene. The effect on survival
in the presence or absence of NGF was assessed as described above. In
these experiments (Fig. 8), a clear
increase in survival following NGF withdrawal was noted in the cells
infected with the BRN-3A virus (p < 0.0001 in
Student's t test and p < 0.0001 in a
single ANOVA test), confirming that this effect could also be observed
in embryonic neurons and using a different method to deliver
BRN-3A.
To extend the studies on the ability of BRN-3A to protect neurons from
different stages of development, we carried out similar studies
examining the effect of overexpressing BRN-3A by liposome-mediated transfection on trigeminal ganglion cultures prepared at different embryonic stages from E11 to E18. Because of the different proportions of NGF-dependent neurons at different embryonic stages, we
cultured the cells in medium containing NGF for 24 h to remove the
neurons that are dependent on other neurotrophins rather than on NGF
(see "Materials and Methods"). We then either removed NGF or
retained it and compared the protective effect of BRN-3A on these
NGF-dependent neurons derived from different embryonic
stages. In these experiments, BRN-3A overexpression had little effect
on survival in the presence of NGF compared with the level of survival
observed in cells treated with vector alone at the different stages of
development examined, presumably because of the high levels of survival
that were observed under these conditions (Fig.
9A). In contrast, in the
absence of NGF, the cultures overexpressing BRN-3A showed clearly
enhanced survival compared with the cultures treated with vector, which was observed at all time points (p < 0.0001 in
Student's t test for comparison of BRN-3A- or
vector-treated cells at all time points tested; Bonferroni's test
confirmed significance at 99% confidence, p < 0.0024). This indicates that overexpression of BRN-3A can protect
trigeminal ganglion neurons at a number of different stages of
embryonic development (Fig. 9B).
As BRN-3A is expressed in trigeminal ganglia throughout this period of
development (25), we also wished to determine whether antisense
inhibition of BRN-3A expression would reduce the survival of trigeminal
ganglion neurons at different developmental stages. As indicated in
Fig. 10, antisense inhibition of BRN-3A
expression led to reduced survival of the trigeminal ganglion neurons
in the presence of NGF when these neurons were derived from the later stages of embryonic development, with highly significant differences in
survival being observed between the vector control- and antisense Brn-3a-treated neurons in cultures prepared from E13 and E14
onward. In contrast, much smaller effects were observed at E12, with no effect at all at E11.
Hence, the endogenous BRN-3A that is expressed in neurons at all these stages (25) appears to play a more significant survival-promoting role as development proceeds. This is in agreement with the finding that the trigeminal ganglia of Brn-3a knockout mice appear to be of normal size early in embryonic development and exhibit significant differences in size from those of wild-type animals only later during embryonic development and postnatally (17, 18). In view of the finding that antisense inhibition of BRN-3A expression
did not affect the survival of early trigeminal ganglion cultures even
though BRN-3A is expressed in such cultures (25), we examined the
ability of the closely related POU factor BRN-3B to protect trigeminal
ganglion cultures at different stages of embryonic development. BRN-3B
was overexpressed in these cells using a plasmid expression vector in
exactly the same manner as BRN-3A, and the survival of these cells was
compared with that of cells treated with expression vector lacking any
insert. In these experiments, no statistically significant alteration
in survival was observed in the cells overexpressing BRN-3B compared with the vector controls in cultures maintained in the presence of NGF
(Fig. 11A).
Similarly, late stage trigeminal ganglion cultures from E13 onward did
not exhibit enhanced survival when they were engineered to overexpress
BRN-3B and NGF was subsequently removed (Fig. 11B), paralleling the lack of effect of BRN-3B in postnatal cultures (data
not shown). Most interestingly, however, trigeminal ganglion cultures
from E11 and E12 did display significantly enhanced survival (p < 0.05) when engineered to overexpress BRN-3B and
subsequently exposed to removal of NGF compared with the survival of
similarly treated control cells transfected with empty expression
vector alone (Fig. 11B). Hence, BRN-3B does appear to be
able to substitute for BRN-3A in early stage trigeminal ganglion
cultures, but not at any later stage. Hence, it is possible that
following antisense inhibition of BRN-3A expression at early stages,
the survival of the neurons is maintained by BRN-3B, which is also
expressed in such early stage trigeminal ganglion neurons, albeit at
low levels (25).
The BRN-3A POU family transcription factor clearly plays an essential role in the correct development of the nervous system, with significant losses of sensory and motor neurons being observed in knockout mice lacking a functional gene for this factor (17, 18). Evidently, these effects could occur because specific neurons fail to develop or because neurons die during development due either to a direct effect of BRN-3A on neuronal survival or to an indirect effect on the ability of neurons to respond to survival-promoting stimuli such as neurotrophins. Our data support a model in which BRN-3A has a direct effect, promoting neuronal survival, rather than an indirect one, regulating the responsiveness of neurons to specific neurotrophic stimuli. Thus, overexpression of BRN-3A in trigeminal or DRG neurons in culture can promote their survival particularly following withdrawal of the neurotrophin NGF. Similarly, a reduction of endogenous BRN-3A expression using an antisense approach results in reduced survival of these cultured neurons, which can be observed both in the presence and absence of NGF. Thus, endogenous BRN-3A is important for the survival of these neurons even under conditions in which they are not exposed to any neurotrophic stimuli; and similarly, BRN-3A overexpression can promote survival following withdrawal of such stimuli. The effects of BRN-3A on neuronal survival are likely to be mediated by the ability of this transcription factor to up-regulate the expression of specific genes involved in neuronal survival. Thus, previous studies have reported that BRN-3A can act as an activator of expression of a wide variety of different genes expressed in neuronal cells (for review, see Refs. 8 and 37), and it is therefore likely that some of the Brn-3a target genes encode protein products that can promote neuronal survival. In particular, we have previously shown that overexpression of BRN-3A in both cultured dorsal root ganglion neurons and an immortalized neuronal cell line can activate the Bcl-2 promoter in cotransfection assays and also results in the activation of the endogenous Bcl-2 gene in a neuronal cell line (22, 23). Hence, we have extended these observations by showing that BRN-3A expression can activate the endogenous Bcl-2 gene in primary sensory neurons and that inhibition of BRN-3A expression reduces endogenous BCL-2 expression. Thus, BRN-3A may promote neuronal survival by activating the expression of the Bcl-2 proto-oncogene, which has a survival-promoting effect. However, mice lacking BCL-2 show significant losses of neurons only after birth (38), whereas the Brn-3a knockout mice show extensive losses much earlier in development (17, 18). Hence, it is likely that BCL-2 is not the only target for activation by BRN-3A. Indeed, we have recently demonstrated that the gene encoding the related BCL-X protein is also activated by BRN-3A.2 This is of particular interest since the extensive neuronal cell losses observed in mice lacking BCL-X occur at a similar time and affect the same populations of neurons as those affected in the Brn-3a knockout mice (39). Interestingly, Huang et al. (40) have recently demonstrated that mice lacking BRN-3A do not produce trkC-expressing neurons rendering the gene encoding this neurotrophin receptor, another candidate for regulation by BRN-3A. Evidently, therefore, a number of potential candidate genes for regulation by BRN-3A exist, and further studies will be required to elucidate which of these are the most important in mediating its effects on neuronal survival. Most interestingly, however, the ability of BRN-3A to promote survival and to up-regulate BCL-2 expression is dependent upon the type of neuron in which the effects of BRN-3A are tested. Thus, as expected, the use of the Brn-3a antisense construct did not result in reduced survival in cultures of sympathetic neurons obtained from superior cervical ganglia since these neurons do not express endogenous BRN-3A (25). More importantly, however, overexpression of BRN-3A was unable to promote the survival of these neurons upon withdrawal of NGF, in complete contrast to the results obtained with postnatal trigeminal or dorsal root ganglion neurons. This effect was paralleled by the inability of BRN-3A to activate the endogenous Bcl-2 gene in sympathetic neurons. These data therefore clearly indicate that the ability of BRN-3A to promote survival is dependent upon the type of neuron investigated. Although the sympathetic neurons represent the most extreme example of this effect in the neuronal types that we have tested, similar effects were also observed within the sensory neuron system. Thus, a difference in responsiveness to BRN-3A was noted during the development of the trigeminal ganglion, with overexpression of BRN-3A having a relatively weak protective effect at the early stages of development compared with that observed at later stages. Similarly, antisense inhibition of BRN-3A had no or an insignificant effect on trigeminal ganglion neuron survival at early stages and a much more dramatic effect at later stages of development. It is of particular interest that we began to observe clear effects of reduced BRN-3A expression in cultured neurons derived from E13 and E14 onward. Thus, in a study of Brn-3a knockout mice, losses of trkA- and trkB-expressing neurons were observed at E12.5 (trkB) and E13.5 (trkA) onward (40). This suggests that the normal survival pattern of trkA- and trkB-expressing neurons may be dependent on the survival-promoting effects of BRN-3A. Hence, BRN-3A may be required both for the formation of trkC-expressing neurons (which do not form in the knockout mice) (40) possibly by directly stimulating the expression of the gene encoding the factor (see above) and also for maintaining the survival of appropriate numbers of trkA- and trkB-expressing neurons during the natural period of programmed cell death. Interestingly, the relatively weak effect of BRN-3A in early trigeminal ganglion cultures contrasts with the clear protective effect of the overexpression of BRN-3B in such cultures, which is in contrast to the inability of BRN-3B to protect later stages of trigeminal ganglion development or adult trigeminal or dorsal root ganglion cultures. Hence, BRN-3B appears to be able to substitute for BRN-3A only at very precise developmental stages. It should be noted, however, that BRN-3B is expressed only at low levels in the early trigeminal ganglion (25). It is therefore clear that specific differences exist between different types of neurons in the nervous system both prior to and after birth in terms of their responsiveness to the survival-promoting effects of BRN-3A as well as their dependence on any endogenous BRN-3A for survival. In this regard, it is of interest that we have demonstrated that the activation of the Bcl-2 promoter by BRN-3A can be observed only in cotransfections of specific neuronal cells and not following transfection into fibroblasts (23). Hence, it is possible that BRN-3A may only be able to activate the Bcl-2 promoter in a limited range of neuronal cells perhaps due to a requirement for a coactivator, which is only present in such cells. It is clear, however, that BRN-3A overexpression can directly promote
the survival of some (but not all) neuronal cell types, whereas its
endogenous expression is essential for the survival of such neuronal
cell types. These results thus establish BRN-3A as a novel
survival-promoting transcription factor for some (but not all) neuronal cells.
* This work was supported by Action Research, the Medical Research Council, and the Sir Jules Thorn Charitable Trust.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Published, JBC Papers in Press, October 25, 2000, DOI 10.1074/jbc.M007068200
2 M. D. Smith, E. Ensor, and D. S. Latchman, unpublished data.
The abbreviations used are: PCR, polymerase chain reaction; E, embryonic day; NGF, nerve growth factor; CMV, cytomegalovirus; GFP, green fluorescent protein; TUNEL, terminal deoxynucleotidyltransferase-mediated biotinylated UTP nick end labeling; ANOVA, analysis of variance; DRG, dorsal root ganglion; SCG, superior cervical ganglion.
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||