| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 49, 46849-46851, December 6, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the International Centre for Genetic Engineering and
Biotechnology (ICGEB), P. O. Box 10504, Aruna Asaf Ali Marg, New
Delhi 110 067, India
Received for publication, September 16, 2002, and in revised form, October 10, 2002
Insecticidal crystal proteins of Bacillus
thuringiensis bind to receptors in the midgut of susceptible
insects leading to pore formation and death of the insect. The identity
of the receptor is not clearly established. Recently a direct
interaction between a cloned and heterologously expressed
aminopeptidase (slapn) from Spodoptera litura
and the Cry1C protein was demonstrated by immunofluorescence and
in vitro ligand blot interaction. Here we show that
administration of slapn double-stranded RNA to S. litura larvae reduces its expression. As a consequence of the
reduced expression, a corresponding decrease in the sensitivity of
these larvae to Cry1C toxin was observed. The gene silencing was
retained during the insect's moulting and development and transmitted
to the subsequent generation albeit with a reduced effect. These
results directly implicate larval midgut aminopeptidase N as receptor
for Bacillus thuringiensis insecticidal proteins.
The bacterium Bacillus thuringiensis
(Bt)1 produces insecticidal
crystal proteins, which upon ingestion by susceptible larvae get
activated in the midgut, interact with specific receptor and form pores
in the epithelium, resulting in the death of the larvae (1).
Understanding the mechanism of action of Bt toxin and development of
resistance in insects is fundamental in sustaining the use of Cry
proteins in integrated pest management. One of the mechanisms of
resistance development is an alteration in the binding ability and/or a
decrease in the population of receptor molecules, which bind Bt toxin
in the insect midgut (2). There have been intense efforts to
characterize the nature of this receptor. As a result of several
independent experiments employing ligand blot analysis and fluorescent
labeling of insecticidal proteins, cadherin and aminopeptidase N (APN)
have emerged as main putative receptor molecules (Ref. 3 and references
there in). While the role of a receptor molecule in mediating the
effect of Cry toxin is acknowledged, the identity of this receptor is
still being worked out.
Aminopeptidase N from Manduca sexta was the first molecule
to be tentatively identified as a Cry toxin-binding protein (4, 5), and
APN is the most extensively studied putative receptor, having been
identified and isolated subsequently from other lepidopteran insect
pests. Independently, a 210-kDa cadherin-like protein from M. sexta was shown to interact with Cry1Ab toxin (6) and later its
presence and toxin interaction was also demonstrated from another
insect, Bombyx mori (7). Relative abundance of APN in the
posterior midgut (8) and lower binding constants of Cry toxin toward
cadherin as compared with APN (9) raised apprehension about the role of
APN as a receptor for Bt toxin in the insect midgut. Moreover, a recent
report shows that high levels of resistance to the Bt toxin, Cry1Ac, in
Heliothis virescens is due to disruption of a cadherin
superfamily gene by retroposon-mediated insertion (10). Although
in vitro experiments such as toxin-induced increase in the
86Rb+ efflux from lipid vesicles reconstituted
with APN and reduction in the inhibition of short circuit current
(ISC) for Cry1Ac following the release of APN from midgut
membrane by phosphatidylinositol phospholipase C treatment
provide support for the role of APN as a receptor, the vital in
vivo evidence for receptor characterization is lacking (5,
11).
RNA interference (RNAi) is a process of dsRNA-mediated gene silencing
in which only the mRNA cognate to dsRNA is specifically degraded
(12-14). Recently, we reported isolation of a 2.8-kb APN-encoding gene
slapn (AF320764), from the midgut of the polyphagous pest, Spodoptera litura, and its expression in the insect cells by
a baculovirus expression vector. By in vitro ligand blot
analysis and immunofluorescence toxin binding studies, we demonstrated a direct interaction between the expressed receptor and Cry1C protein
(15). Here we report that dsRNA-mediated silencing of the
aminopeptidase N gene results in increased resistance of S. litura larvae to Cry1C protein, thereby demonstrating a functional role for this protein in Cry protein-mediated toxicity.
Insect Rearing, Midgut Isolation, and RNA
Preparation--
S. litura larvae were reared on fresh
castor leaves (Ricinus communis) under a photoperiod of
14:10 h (light:dark), 70% relative humidity, and 27 °C.
Midguts from 6th instar 1st day larvae were dissected in DEPC-treated
water, snap-frozen into liquid nitrogen, and stored at Bioassay--
Inclusion bodies (IB) of Cry1C toxin were prepared
as reported earlier by Lee (16). The amount of the toxin was
quantitated densitometrically by resolving the IB on SDS-PAGE. Toxin
amounts from 1000 to 10,000 ng was diluted in 10 mM Tris,
pH 7.5, and 10 µl of each concentration was coated on both the sides
of a castor leaf disc (area = 3.8 cm2). The
toxin-coated leaf disc was air-dried and placed in a well of a 12-well
tissue culture plate (Nunc Inc). One 6th instar 1st day larva was
released on each well and exposed to the toxin treatment for 24 h.
After 24 h the larva was transferred to fresh castor leaves
(without toxin). Mortality was recorded after 4 days and the
LC50 value calculated by Probit analysis using the software Indo Stat (Indostat Services, Hyderabad, India). Ten larvae were tested
for each treatment and the bioassay replicated three times. LC50 values were also determined for neonate larvae of
S. litura by coating castor leaf discs with different doses
of Cry1C toxin and scoring the mortality in each treatment after
72 h. 10 neonate larvae were released on each leaf disc, and each
treatment was replicated five times.
Preparation of dsRNA--
The dsRNA was prepared following the
procedure prevoiusly described by us (17). A 756-bp fragment, from
amino acid 609 to 861, was amplified from the S. litura APN gene and subcloned in pGEM-Te. The cloned fragment was
amplified using vector-specific universal and reverse primers
(Promega). The PCR product was purified using PCR purification kit
(Qiagen GmbH) and used as a template to generate sense RNA
(sRNA) and antisense RNA (asRNA) using T7 and SP6 RNA polymerases
(Ambion), respectively. To make dsRNA, equal amounts of sRNA and asRNA
were mixed, heated to 65 °C, and annealed by slow cooling over
4 h followed by DNase (Invitrogen) treatment for 15 min at
37 °C. The dsRNA was extracted with phenol:chloroform and
precipitated overnight with ice-cold ethanol in the presence of 0.3 M sodium acetate at Injection of dsRNA and Quantitative RT-PCR--
Varying doses of
dsRNA were injected intrahemocoelically into early 5th instar S. litura larvae using a microapplicator (KDS 200, KD Scientific
Inc., New Hope, PA). After 48 h, the insect midguts were
dissected, and total RNA was extracted. The quantity of RNA in each
treatment was normalized by amplifying the BBMV Preparation and Western Blotting--
BBMVs were prepared
from 6th instar midgut by following the protocol of Wolfersberger (18).
One microgram of the BBMV protein was resolved by 7.5% SDS-PAGE and
electrotransfered to nitrocellulose membranes at 50 mA for 2 h at
4 °C. The blot was blocked in 3% bovine serum albumin in 1×
phosphate-buffered saline and then incubated with 1:50,000 dilution of
anti-APN antibodies. Subsequently, the blot was incubated with alkaline
phosphatase-conjugated goat anti-rabbit IgG and developed with NBT-BCIP substrate.
Low Molecular Weight (LMW) RNA Extraction and Detection--
Low
molecular weight RNA was isolated from midgut of insects injected with
To evaluate the functional role of aminopeptidase N in the
insecticidal activity of Cry1C in vivo, we sought to
specifically inhibit the expression of slapn by its
corresponding dsRNA. The reported routes of dsRNA delivery in lower
eukaryotes such as Caenorhabditis elegans are soaking,
feeding, or injection of dsRNA solution into the worm (12, 20), while
dsRNA in Drosophila melanogaster was introduced by injecting
into eggs. D. melanogaster embryos hatched from
dsRNA-injected eggs displayed nearly 75% gene-silencing, which reduces
to 3% with maturity (21). Preliminary experiments to introduce dsRNA
into neonate larvae of S. litura by soaking them in dsRNA
solution or by feeding through diet were unsuccessful, since no
reduction in transcript levels was detected. Subsequently, varying
amounts of dsRNA were injected into hemolymph of 5th instar larvae (2 µl/insect) using a microapplicator (KDS 200, KD Scientific Inc.).
After 48 h of injection of dsRNA the transcript abundance was
estimated by relative RT-PCR. An injection of 4 µg of dsRNA resulted
in a 95% reduction over control of midgut slapn transcript
levels (Fig. 1a, lanes
1 and 2).
The consequence of decrease in slapn transcript on the
susceptibility of S. litura larvae against Cry1C protein was
examined by performing toxicity assays. Initially, the assays were
performed on freshly moulted, 6th instar larvae (injected with 2 µl
of DEPC-treated water in 5th instar), a developmental stage
corresponding to the growth status of 5th instar larvae after 48 h
of injection. These larvae were released on 3.8-cm2 castor
leaf discs coated with various concentrations of Cry1C protein (1-10
µg). Mortality was recorded after 4 days and LC50 (50%
lethal concentration) value calculated by probit analysis. The
calculated LC50 value was 5.642 µg/disc with the
regression equation, y = 5.1921x-14.478, and
the fiducial limits lie between 5.355 and 6.025 µg. Larvae injected
with dsRNA and released on castor leaf discs coated with 6 µg of
Cry1C displayed reduction in the mortality rate. The increase in
tolerance for dsRNA-injected larvae to Cry1C protein correlated with a
comparable (70%) increase in the larvae that pupated. On the other
hand, none of the control larvae could reach pupation (Table
I).
ACCELERATED PUBLICATION
Silencing of Midgut Aminopeptidase N of Spodoptera
litura by Double-stranded RNA Establishes Its Role as
Bacillus thuringiensis Toxin Receptor*
,,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
70 °C.
Total RNA was isolated from the midgut tissue using TRIzol
reagent (Invitrogen) according to manufacturer's protocol. The amount
of RNA was quantitated spectrophotometrically at 260 nm.
20 °C. The pellet was washed with 75% ethanol and resuspended in 50 µl of DEPC-treated water.
-actin gene in each
treatment to equal intensity after 20 cycles of RT-PCR using the Titan
one-tube RT-PCR kit (Roche Diagnostics Gmbh). The amplification
regimen was as follows: reverse transcription at 43 °C for 35 min
followed by 20 PCR cycles of denaturation at 94 °C for 30 s,
re-annealing at 51 °C for 30 s, and extension at 72 °C for
30 s followed by a final extension of 10 min at 72 °C. Using
this normalized amount of RNA as template, the slapn transcript in different treatments was compared by amplifying a 756-bp
part of the slapn gene. Before loading on 1% agarose gel
the RT-PCR products were treated with 1 µg of RNase (Qiagen GmbH) at
37 °C for 10 min to eliminate template RNA, since it hinders the
correct estimation of the -actin gene product in the gel. The gels
were photographed with Polaroid 667 black and white print film and
scanned for net intensity of each RT-PCR product using the software
Kodak 1D, version 2.0.
-32P-labeled dsRNA following the protocol of Hamilton
and Baulcombe (19) and resolved on 12% acrylamide 7 M urea
gel in 1× TBE buffer (10.8 g of Tris, 5.5 g of boric acid, 4.0 ml of
0.5 M EDTA, pH 8.0, made up to 1 liter with water).
The gel was dried and exposed to a Kodak Bio-Max MR autoradiographic
film overnight at 70 °C. The film was developed to detect the
occurrence of radiolabeled siRNA.
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
View larger version (25K):
[in a new window]
Fig. 1.
Introduction of dsRNA corresponding to
slapn gene into S. litura larvae
results in its silencing. a, relative RT-PCR with
-actin (-actin F, 5'cagatcatgtttgagaccttcaac3'; -actin R,
5'gsccatctcytgctcgaartc3') and S. litura apn (APN F,
5'agcactttcatcgtacctga3'; APN R, 5'agcttcaccaccatatgtag3') primers on
total RNA isolated from: midguts of control 6th instar larvae
(lane 1), midgut of dsRNA injected 6th instar larvae
(lane 2), neonate from untreated parentage (lane
3), and neonate of F1 generation whose parents were injected with
dsRNA (lane 4). b, the Western blot of BBMV
proteins (1 µg) prepared from 6th instar control larvae (lane
1) and dsRNA-injected larvae (lane 2) was probed with
polyclonal anti-SLAPN antibodies and developed with NBT/BCIP.
c, generation of 25-mer small interfering RNA in dsRNA
injected larvae (lane 1) and dsRNA used for injection
(lane 2). Lane M indicates marker. Bands were
analyzed for their net intensity by spot densitometry using the
software Kodak 1D, version 2.0.
Reduction in S. litura's toxicity to Cry1C by dsRNA
To examine the effect on the expression of APN upon dsRNA delivery, BBMVs were prepared by the differential MgCl2 method from the midgut of 6th instar larvae and resolved by 7.5% SDS-PAGE. Probing the BBMV proteins with anti-APN antibodies revealed nearly 80% reduction in APN expression in dsRNA-injected larvae as compared with control larvae (Fig. 1b). Thus the reduction in the expression of aminopeptidase correlates well with the reduction of slapn transcript levels and the decreased sensitivity to Cry1C proteins (Fig. 1a).
Fifth instar larvae injected with slapn dsRNA were reared up to pupation and bred into the next generation. Analysis of neonate larvae for abundance of slapn transcript revealed 60% reduction in slapn levels (Fig. 1a, lanes 3 and 4). Neonate larvae of the F1 generation with slapn silencing displayed resistance to Cry1C toxin compared with untreated neonate larvae (Table I). The LC50 value of Cry1C on untreated neonate larvae was 200 ng/3.8 cm2.
An important step in RNAi-mediated gene silencing is the formation of
21-25-nt siRNAs, which target and degrade mRNA of the target gene
(22). In the present study, the generation of siRNA was investigated by
extracting LMW RNA (19) from the midgut of larvae injected with
-P32-labeled dsRNA. By resolving the LMW RNA preparation
on PAGE, a distinct band corresponding to 25 nt is observed (Fig.
1c). Occurrence of a 25-mer oligonucleotide establishes that
RNAi pathway in larvae is similar to that observed in other organisms.
Thus in the present study, we have demonstrated that the dsRNA-mediated
silencing of slapn in whole S. litura larvae
resulted in the decrease in the amount of APN expressed in the
epithelial membrane of midgut cells, which in turn enabled the larvae
to tolerate lethal concentrations of the Cry1C protein. By performing in vivo experiments we are able to provide a direct evidence
for the role of APN as a Bt toxin receptor in the midgut of insects. The silencing of the S. litura apn by introducing cognate
dsRNA into larvae demonstrates that RNAi functions in whole larvae and also that the midgut columnar cells can take up dsRNA molecules injected in the hemocoel. This result shows that like in the plant kingdom, there is a "systemic" effect of RNAi in animals too, in
organs away from the point of delivery of dsRNA. Also, we show that
RNAi effect by dsRNA administration is heritable in the next generation, as comparable with the interference obtained by using "hairpin-loop" RNA (23). Here, we have used RNAi as a technique to
probe the function of a protein as a toxin receptor, thereby implying
that it can be used to explore the functional role of different
proteins involved in various host-pathogen interactions.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
These authors contributed equally to this work.
§ To whom correspondence should be addressed: Insect Resistance Group, ICGEB, P. O. Box 10504, Aruna Asaf Ali Marg, New Delhi 110 067, India. Tel.: 91-11-6195007 (or 91-11-6177357, 91-11-6189358, 91-11-6189360, or 91-11-6189361); Fax: 91-11-616-2316; E-mail: raj@icgeb.res.in.
Published, JBC Papers in Press, October 10, 2002, DOI 10.1074/jbc.C200523200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: Bt, Bacillus thuringiensis; APN, aminopeptidase N; BBMV, brush border membrane vesicles; NBT, nitro blue tetrazolium; BCIP, 5-bromo-4-chloro-3-indolyl phosphate toluidine; Cry, crystalline inclusion protein; dsRNA, double-stranded RNA; RNAi, RNA interference; LMW, low molecular weight; IB, inclusion bodies; siRNA, small interfering RNAs; sRNA, sense RNA; asRNA, antisense RNA; DEPC, diethyl pyrocarbonate; RT, reverse transcriptase; nt, nucleotide(s).
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
|
|---|
| 1. |
Schnepf, E.,
Crickmore, N.,
Van Rie, J.,
Lereclus, D.,
Baum, J.,
Feitelson, J.,
Zeigler, D. R.,
and Dean, D. H.
(1998)
Microbiol. Mol. Biol. Rev.
62,
775-806 |
| 2. | Gould, F. (1998) Annu. Rev. Entomol. 43, 701-726[CrossRef][Medline] [Order article via Infotrieve] |
| 3. | Jenkins, J. L., and Dean, D. H. (2000) in Genetic Engineering Principles and Methods (Setlow, J. K., ed), Vol. 22 , pp. 33-54, Kluwer Academic/Plenum Publishers, New York |
| 4. | Knight, P. J. K., Crickmore, N., and Ellar, D. J. (1994) Mol. Microbiol. 11, 429-436[Medline] [Order article via Infotrieve] |
| 5. |
Sangadala, S.,
Walters, F. S.,
English, L. H.,
and Adang, M. J.
(1994)
J. Biol. Chem.
269,
10088-10092 |
| 6. |
Vadlamudi, R. K.,
Weber, B., Ji, I., Ji, T. H.,
and Bulla, L. A.
(1995)
J. Biol. Chem.
270,
5490-5494 |
| 7. | Nagamatsu, Y., Koike, T., Sasaki, K., Yoshimoto, A., and Furukawa, Y. (1999) FEBS Lett. 460, 385-390[CrossRef][Medline] [Order article via Infotrieve] |
| 8. | Carroll, J., Wolfersberger, M. G., and Ellar, D. J. (1997) J. Cell Sci. 110, 3099-3104[Abstract] |
| 9. | Jenkins, J. L., and Dean, D. H. (2001) BMC Biochemistry 2, 12 |
| 10. |
Gahan, L. J.,
Gould, F.,
and Heckel, D. G.
(2001)
Science
293,
857-860 |
| 11. | Lee, M., You, T., Young, B., Cotrill, J., Valaitis, A., and Dean, D. (1996) Appl. Environ. Microbiol. 62, 2845-2849[Abstract] |
| 12. | Fire, A., Xu, S. Q., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Nature 391, 806-811[CrossRef][Medline] [Order article via Infotrieve] |
| 13. | Kennerdell, J. R., and Carthew, R. W. (1998) Cell 95, 1017-1026[CrossRef][Medline] [Order article via Infotrieve] |
| 14. | Lee, N. S., Dohjima, T., Bauer, G., Li, H., Li, M. J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002) Nat. Biotechnol. 20, 500-505[Medline] [Order article via Infotrieve] |
| 15. |
Agrawal, N.,
Malhotra, P.,
and Bhatnagar, R. K.
(2002)
Appl. Environ. Microbiol.
68,
4583-4592 |
| 16. |
Lee, M. K.,
Milne, R. E., Ge, Z.,
and Dean, D. H.
(1992)
J. Biol. Chem.
267,
3115-3121 |
| 17. | Malhotra, P., Dasaradhi, P. V. N., Kumar, A., Mohmmed, A., Agrawal, N., Bhatnagar, R. K., and Chauhan, V. S. (2002) Mol. Microbiol. 45, 1245-1254[CrossRef][Medline] [Order article via Infotrieve] |
| 18. | Wolfersberger, M. G., Luthy, P., Maurer, A., Parenti, P., Saachi, V. F., Giordana, B., and Hanozet, G. M. (1987) Comp. Biochem. Physiol. A 86, 301-308[CrossRef] |
| 19. |
Hamilton, A. J.,
and Baulcombe, D. C.
(1999)
Science
286,
950-952 |
| 20. |
Tabara, H.,
Grishok, A.,
and Mello, C.
(1998)
Science
282,
430-431 |
| 21. |
Misquitta, L.,
and Paterson, B. M.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
1451-1456 |
| 22. | Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000) Cell 101, 25-33[CrossRef][Medline] [Order article via Infotrieve] |
| 23. | Kenderdell, J. R., and Carthew, R. W. (2000) Nat. Biotechnol. 18, 896-898[CrossRef][Medline] [Order article via Infotrieve] |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Q. Yu, T. Lin, G. Feng, K. Yang, and Y. Pang Functional analysis of the putative antiapoptotic genes, p49 and iap4, of Spodoptera litura nucleopolyhedrovirus with RNAi J. Gen. Virol., August 1, 2008; 89(8): 1873 - 1880. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. R. Pigott and D. J. Ellar Role of Receptors in Bacillus thuringiensis Crystal Toxin Activity Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 255 - 281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sivakumar, R. Rajagopal, G. R. Venkatesh, A. Srivastava, and R. K. Bhatnagar Knockdown of Aminopeptidase-N from Helicoverpa armigera Larvae and in Transfected Sf21 Cells by RNA Interference Reveals Its Functional Interaction with Bacillus thuringiensis Insecticidal Protein Cry1Ac J. Biol. Chem., March 9, 2007; 282(10): 7312 - 7319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ohnishi, J. J. Hull, and S. Matsumoto Targeted disruption of genes in the Bombyx mori sex pheromone biosynthetic pathway PNAS, March 21, 2006; 103(12): 4398 - 4403. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Avisar, M. Segal, B. Sneh, and A. Zilberstein Cell-cycle-dependent resistance to Bacillus thuringiensis Cry1C toxin in Sf9 cells J. Cell Sci., July 15, 2005; 118(14): 3163 - 3171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Atsumi, E. Mizuno, H. Hara, K. Nakanishi, M. Kitami, N. Miura, H. Tabunoki, A. Watanabe, and R. Sato Location of the Bombyx mori Aminopeptidase N Type 1 Binding Site on Bacillus thuringiensis Cry1Aa Toxin Appl. Envir. Microbiol., July 1, 2005; 71(7): 3966 - 3977. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Griffitts, S. M. Haslam, T. Yang, S. F. Garczynski, B. Mulloy, H. Morris, P. S. Cremer, A. Dell, M. J. Adang, and R. V. Aroian Glycolipids as Receptors for Bacillus thuringiensis Crystal Toxin Science, February 11, 2005; 307(5711): 922 - 925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Avisar, M. Keller, E. Gazit, E. Prudovsky, B. Sneh, and A. Zilberstein The Role of Bacillus thuringiensis Cry1C and Cry1E Separate Structural Domains in the Interaction with Spodoptera littoralis Gut Epithelial Cells J. Biol. Chem., April 16, 2004; 279(16): 15779 - 15786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Agrawal, P. V. N. Dasaradhi, A. Mohmmed, P. Malhotra, R. K. Bhatnagar, and S. K. Mukherjee RNA Interference: Biology, Mechanism, and Applications Microbiol. Mol. Biol. Rev., December 1, 2003; 67(4): 657 - 685. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
