 |
INTRODUCTION |
The CD28 molecule is a T cell-restricted membrane glycoprotein
that provides the requisite costimulatory signal for the induction and
maintenance of T cell-mediated immune responses (1, 2). Coengagement of
CD28 with the T cell receptor enhances the synthesis of several humoral
growth factors including interleukin-2 and of anti-apoptotic molecules
(3, 4). Hence, T cells either become anergic or undergo apoptosis in
the absence of CD28 signals. Targeted deletion of the CD28 gene in
laboratory mice has been found to result in immunocompromised animals
because of defective T cell activation (5-7). These findings
underscore the central role of CD28 in adaptive immunity.
Although CD28 is constitutively expressed on all T cells,
CD28null T cells are typically found in the immune system
of the elderly, in both CD8+ (8, 9) and CD4+
compartments (10). CD28null cells have highly shortened
telomeres compared with their CD28+ counterparts,
indicating their long replicative history (11). These unusual cells are
also highly oligoclonal (9, 12), occurring at large clonal sizes that
contribute to the contraction of the T cell repertoire diversity.
Because of the limited replicative lifespan of T cells (13),
CD28null cells are thought to be biological indicators of
immunosenescence. Interestingly, CD28null CD4+
T cells have also been found in high frequencies among patients with
chronic inflammatory conditions such as rheumatoid arthritis (14),
Wegener's granulomatosis (15), and unstable coronary artery disease
(16). In these pathological states, large clonal populations of these
cells have been postulated to represent a pool of prematurely senescent
T cells resulting from chronic immune activation (10, 17, 18).
The CD28null T cell phenotype is generally stable and lacks
specific transcripts of all the known splice variants of CD28 (18-21) resulting from a transcriptional block. Our studies show that the basal
transcription of the CD28 gene is regulated by two sequence motifs
sites 
and 
, in the gene promoter, situated downstream from an
atypical TATA box (10). These sequences constitute a functionally
singular transcriptional initiator
(INR)1 element (18). In
reporter gene bioassays and in vitro transcription studies,
mutation in or deletion of either motif is sufficient to inactivate the
CD28 gene promoter. In CD28null T cells, the -INR is
functionally inoperative because of the coordinate lack of sites -
and -specific transcription factors (18, 20). Although INRs are
classically defined as nucleation sites of the basal transcription
initiation complex (22, 23), these findings indicate that loss (or
gain) of INR activity may also be a critical determinant of cell
phenotype and function.
Because the CD28 -INR has no homology with other INRs (18, 24,
25), we undertook studies to characterize the relevant INR-binding
proteins. We utilized a combination of affinity chromatography in
concert with matrix-assisted laser desorption ionization-time of
flight-mass spectrometry (MALDI-TOF-MS) and nanocapillary liquid chromatography-nanospray tandem mass spectrometry (nLC-MS/MS) to
identify the proteins associated with the DNA-binding complex. By these
approaches, we identified two of the component proteins of the
transcription factor complex which recognize site of the CD28 INR.
Here, evidence is also presented that the specific removal of either
protein component of the site -binding complex effectively inhibits
the trans-activation of -INR-driven DNA templates. The
present work therefore provides a biochemical basis supporting the
notion that the CD28 INR is indeed a structurally bipartite but
functionally singular core promoter element.
| |
EXPERIMENTAL PROCEDURES |
Cell Culture and Nuclear Extracts--
Jurkat (ATCC), a
prototypical CD28+ T cell line (18), was propagated in RPMI
1640 medium supplemented with 10% fetal calf serum at 37 °C in a
humidified 5% CO2 incubator. Cells were maintained in
batches of 250-ml flask cultures or 1-liter minibioreactors. Nuclear
extracts were routinely prepared from bulk cultures when the cell
density reached 5 × 106 cells/ml. Nuclear extracts
were prepared as described previously (10, 20) and stored at 
70 °C
until use. In these studies, a 75-liter culture was processed for
nuclear protein extraction. Total protein concentration was determined
colorimetrically using the Bio-Rad protein assay reagent.
HUT78 (ATCC), a prototypical CD28null T cell line (10, 18),
was also propagated in complete RPMI medium but supplemented with 20 units/ml human recombinant interleukin-2 (ProleukinTM, Chiron, Emeryville, CA).
Derivation and propagation of nontransformed CD4+
CD28+ and CD28null T cell lines and clones have
been described previously (10, 12, 20).
T cells used in the present studies were routinely subjected to
phenotypic screening by direct immunofluorescence staining for CD3,
CD4, and CD28 and analyzed by flow cytometry as described previously
(10, 18-21). Expression, or lack thereof, of CD28 was also confirmed
by reverse transcription (RT)-PCR assays using amplification primers
for all of the known variants of CD28 as described elsewhere (20).
Affinity Chromatography--
Nuclear extracts were dialyzed
against 10 volumes of a hypotonic Hepes buffer pH 7.0 (10, 20)
containing a protease inhibitor mixture (Roche Molecular Biochemicals),
concentrated by centrifugation dialysis in Centricon YM-3
filters (Millipore), and subjected to sequential adsorption by column
chromatography. The adsorption columns were agarose matrices of
immobilized commercial DNA (Amersham Biosciences), heparin, and
strepavidin (Pierce). The flow-through from the strepavidin column was
subsequently poured into an affinity column with immobilized
double-stranded, biotinylated, synthetic oligonucleotide corresponding
to site of the CD28-INR or its mutated variant M3 (10). The
affinity column was washed aseptically with 10 volumes of Hepes buffer
in the absence of peptide protease inhibitors. Bound proteins were
eluted with 2 M KCl and concentrated by centrifugation
dialysis against 10 volumes of sterile 10 mM Hepes pH
7.0.
The simple design of the affinity purification for site -binding
proteins was based on empirical studies using microcolumns (data not
shown). Additional adsorption/clearing steps such as the use of DEAE or
Mono Q columns neither improved the elution yields nor altered the
binding specificity of the site oligonucleotide affinity column. As
expected, incubation of precleared nuclear extracts with excess amounts
of soluble site oligonucleotides resulted in a significant
reduction in the amounts, or the complete lack, of proteins that can be
eluted from the affinity column. In these latter experiments, the
absence of proteins eluted from the columns was confirmed by SDS-PAGE
and silver staining and by MALDI-TOF-MS (below).
MS Studies--
Eluates from DNA affinity columns were initially
subjected to MALDI-TOF-MS to examine the relative diversity of the
isolated site -specific protein complexes. Samples were desalted on
a C4 ZipTip cartridge (Millipore). Retained proteins were eluted with a
2-µl matrix solution of 10 µg/µl 3,5-dimethoxy-4-hydroxycinnamic acid in 55% acetonitrile (ACN), 0.1% trifluoroacetic acid. Two 0.8-µl aliquots were loaded onto a 0.5-µl sinnapinnic acid matrix precrystallized in 70% ACN and 0.1% trifluoroacetic acid. Mass spectra were acquired using a Voyager-DE STR mass spectrometer (Perseptive Biosystems, Framingham, MA) by delayed extraction using
either the reflectron or linear mode. Acceleration grid and guide wire
voltages were set to 20,000 V, at 70% or 0.08%, respectively. The low
mass gate was set to either 600 or 5,000. External calibration in
linear mode was performed using doubly and singly charged ions from
bovine serum albumin prepared by the same procedure as the sample eluates.
MS/MS was performed to identify the site -specific proteins by
examining the peptide fragmentation fingerprints of the affinity column
eluates. Desalted samples (see above) were dissolved in 10 mM Hepes pH 8.0 to a maximum concentration of 2.5 µg/µl
and subjected to cysteine reduction and alkylation. Dithiothreitol (in
1 M Tris-HCl pH 8.8) was added to the samples to a final
concentration of 1 µg/µl and incubated for 30 min at 37 °C.
Samples were cooled to room temperature, iodoacetamide was added to a
concentration of 2 µg/µl, and the samples were incubated for 30 min
in the dark. Subsequent to reduction and alkylation, samples were
diluted with an equal volume of 100 mM Tris-HCl buffer to a
final concentration of 1.25 µg/µl and digested overnight with
trypsin (E/S 1:50) at 37 °C. Trypsin digestion
was stopped with the addition of 10% formic acid. Aliquots of the
trypsin-digested material were diluted with an equal volume of 0.1%
trifluoroacetic acid and loaded onto a ZipTip cartridge packed with C18
reverse material (Millipore) as described by the manufacturer. Peptides
were eluted with 3 µl of matrix solution (12 µg/µl
-cyano-4-hydroxycinnamic acid in 45% aqueous ACN and 0.1%
trifluoroacetic acid).
Peptides were subjected to nLC-MS and MS/MS as described previously
(26). Briefly, reversed phase 
scale LC separations were done on a
prepacked 75-µm inner diameter/5-cm long PicroFrit column (New
Objective Inc., Cambridge, MA) packed with 5-µm particles of Aquasil
C18 (ThermoHypersil-Keystone, Bellefonte, PA). Peptides were eluted at
a flow rate of 0.2 µl/min utilizing a linear gradient as follows:
initial hold at 0% B for 10 min, 1-min ramp to 10% B, 10-50% B over
30 min, 50-95% B over 5 min, hold 5 min at 95% B, return to 0% B
over 5 min, and reequilibration for 5 min prior to new injection.
Mobile phase A consisted of water/ACN/n-propyl alcohol
(98/1/1 v/v/v) containing 0.2% formic acid. Mobile phase B consisted
of ACN/n-propyl alcohol/water (80/10/10 v/v/v) containing 0.2% formic acid. Mobile phase flows at 50 µl/min were supplied by a
Michrom UMA LC system (Michrom Bioresources Inc., Auburn, CA). A
contact closure event table within the LC software was used to send
start signals to the autosampler, control the LC switching valve, and
send acquisition start signals to the mass spectrometer. A 10-min (10 min × 10 µl/min = 100 µl) sample transfer and wash step
was built into the beginning of the reversed phase scale LC method
to allow reconcentration on the mPC disk (SDB-EX styrene/divinylbenzene
disk, Varian Inc., Harbor City, CA) while simultaneously
reequilibrating the scale LC column from the previous gradient. At
the conclusion of 10 min, the mPC disk was switched on-line with the
LC column, the gradient started, and mass spectrometer data
acquisition commenced.
Typically, 5-8 µl of the digested protein sample was concentrated on
the mPC membrane. Because the SDB material in the mPC disk is less
rententive than the C18 LC column, it allowed analytes eluting from
the membrane to be refocused briefly on the head of the LC column
during the reversed phase gradient.
Nanospray ESI-MS was performed using a Micromass Q-TOF II
(Micromass, Beverly, MA) equipped with a modified Micromass
ESI source. The source was modified by replacing the mounting
platform on the X/Y/Z manipulator with a 2-piece platform of stainless steel on top of insulating Delrin that contains a grid of mounting holes. A titanium microvolume union with 150-µm bore (Valco, Houston, TX) was mounted to the platform via the bulkhead threads in the union
and a nylon screw. The electrospray voltage, typically 1.7-2.1 kV, was
applied to the metal microvolume union through the stainless steel
mounting plate. The Delrin base of the platform serves to insulate
electrically the spray platform from the rest of the X/Y/Z manipulator
assembly. Spectra were acquired on either the MS or the auto MS/MS
mode. Auto MS/MS experiments were conducted using survey scans to
choose up to three precursor ions. Collision energies were chosen
automatically as a function of m/z value and
charge. Argon was used as the collision gas. The mass axis of the TOF
analyzer was calibrated by manually injecting 0.3 µl of 0.1 mg/ml NaI
dissolved in isopropyl alcohol/water (50/50 v/v) through the LC
column. The solution also contained a small amount of cesium ion
allowing calibration over the m/z range
132.9054-1821.7206 using a linear fit of the calibration points.
Data base searches were carried out using either accurate peptide
masses or partial sequence information. Searches were performed utilizing the Protein Prospector search algorithm (prospector.ucsf.edu) MS-Fit or the Mascot search program (Matrix Science Limited,
www.matrixscience.com), and the NCBI protein data base.
Electrophoretic Mobility Shift Assays (EMSAs)--
Purity of the
samples at each phase of column chromatography was monitored by EMSAs,
which were performed as described previously (10, 20). As indicated,
EMSAs were carried out with the addition of specific antibodies or the
appropriate isotype control immunoglobulin (Ig) or preimmune antiserum
to the binding reactions. In these studies, the anti-nucleolin
monoclonal antibody MS3 (27) (provided by Dr. Ben Valdez, Baylor
College of Medicine) and four rabbit antisera to heterogeneous nuclear
ribonucleoprotein (hnRNP)-D0 (provided by Dr. Mate Tolnay, Walter Reed
Research Institute) were used at the indicated dilutions. The
specificities of these rabbit antisera to the A (P3, P4) and B isoforms
(P1) or to a conserved region (P2) of hnRNP-D0 have been described
previously (28, 29).
Competitive EMSA was also carried out as described previously (10).
Sequences corresponding to the Ig switch region recognized by a B
cell-specific transcription factor LR1 (30, 31), the hnRNP-D0B
binding motif in the complement receptor 2 (CR2) promoter (28, 32), or
the mutated variant (M3) of site (10) were used as competitors to
the CD28 site binding probe.
DNA binding assays were also conducted using LR1 and CR2
double-stranded oligonucleotide sequences as binding probes. In other assays as indicated, single-stranded oligonucleotides of site were
also used as binding probes.
In Vitro Transcription Assay--
Transcription assays with
INR-driven DNA templates were conducted as described previously (18).
CD28-INR-driven DNA templates contained either the wild type or mutated
variants of site (M3, M4) or site (M9, and M10) (10). Mutants
were generated by the gene splicing by overlap extension technique
described elsewhere (33).
For assays using immunodepleted extracts, batches of 100-µg aliquots
of dialyzed nuclear extracts were incubated overnight at 4 °C with
saturating amounts of anti-nucleolin (MS3) or anti-hnRNP-D0A (P3, P4),
or equivalent amounts of IgG or preimmune serum. To this mixture,
protein A/G-agarose (Pierce) was added and incubated for another 6 h at 4 °C. Supernatants were collected after brief centrifugation
and concentrated by centrifugation dialysis in Microcon YM-3
filters (Millipore). Protein concentration was determined using the
Bio-Rad protein assay reagent. Thirty µg of each of the
antibody-cleared extracts was used in transcription assays using CD28
-INR-driven DNA templates.
In similar experiments, the immunoprecipitated protein complexes were
added back the antibody-cleared extracts. Protein A/G-bound proteins
from the depletion experiments were subjected to high salt elution,
concentrated by centrifugation dialysis, and 20 µg of the concentrate
was added to the antibody-cleared extract and used in transcription assays.
DNA templates containing either the wild type or mutated form of the
INR of the terminal deoxynucleotidyltransferase (TdT) gene (34) were
also used as system controls.
Western Blotting--
Nuclear extracts from CD28+
and CD28null T cells were prepared as described above, and
10-µg aliquots were subjected to SDS-PAGE under reducing conditions
in 10% polyacrylamide gels. Fractionated proteins were transferred to
nitrocellulose membranes (0.2-µm sieve, Bio-Rad) by standard
electroblotting procedures. Membranes were blocked with 4% bovine
serum albumin in Tris-buffered saline pH 7.4 for 1 h, followed by
a 1-h incubation in a 1/1,000 dilution (in Tris-buffered saline
containing 1% bovine serum albumin and 0.25% Tween 20) of the
anti-nucleolin antibody MS3 (27) or the P4 rabbit antiserum to
hnRNP-D0A (29). Membranes were washed extensively in the Tris-buffered
saline-bovine serum albumin-Tween dilution buffer and subsequently
incubated for 1 h in a 1:1/000 dilution of horseradish
peroxidase-conjugated goat anti-mouse Ig (BD Biosciences) or goat
anti-rabbit IgG/IgL (BIOSOURCE Intl., Camarillo,
CA) for MS3- or P4-treated membrane, respectively. The membranes were
again washed extensively in Tris-buffered saline-bovine serum
albumin-Tween dilution buffer, and the immunoblots were developed by
chemoluminescence using the SuperSignal kit (Pierce).
Isolated site -bound proteins were also subjected to Western
blotting to ascertain the presence of nucleolin and hnRNP-D0A in the
DNA·protein complexes. Approximately 100-µg samples of nuclear extracts from Jurkat and HUT78 cells were incubated separately with 100 µl of freshly washed strepavidin-agarose slurry (Pierce) for
2 h at 4 °C. After a brief centrifugation, the precleared extracts were divided into two aliquots; one was left on ice until use,
and the other was added to a 500-µl EMSA binding reaction (as
described above) containing 10 nmol of biotinylated site sequences
and incubated on ice for 1 h.
A fresh 100-µl slurry of strepavidin-agarose was washed three times
with the reaction buffer. After the last centrifugation, the
supernatant was discarded by vacuum aspiration, and the EMSA binding
reaction was poured into the strepavidin-agarose pellet. The mixture
was incubated for 1 h at 4 °C in a rotating wheel. After a
brief centrifugation, the supernatant was carefully aspirated off into
a microfuge tube and left on ice. The DNA·protein
complexes/strepavidin-agarose pellet was washed twice by centrifugation
in 3 volumes of the binding reaction buffer. The binding reaction
supernatant and the DNA-bound fraction, along with the precleared
nuclear extract, were each mixed with an equal volume of 2× Laemmli
buffer, and 100-µl aliquots were subjected to SDS-PAGE and Western
blotting for nucleolin and hnRNP-D0A as described above. As system
control, similar immunoblotting experiments were conducted using the
monoclonal antibody 4B10 (35) (provided by Dr. Gideon Dreyfuss, HHMI,
University of Pennsylvania), which specifically recognizes the
RNA-binding protein hnRNP-A1 (36) but not the isoforms of hnRNP-D0.
RT-PCR Assay for hnRNP-D0A--
Total RNA from a panel of T
cells, as indicated, was prepared using the Trizol reagent (Invitrogen)
and subjected to first strand cDNA synthesis by standard
procedures. Aliquots of cDNA samples were subjected to PCR using
specific primers. The sequences of the primer pairs used were
gaggtggtggccccagt and cactctgctggttgctataatc, which amplified a 168-bp
product corresponding to exon 7 of hnRNP-D0A (GenBankTM accession no.
D55674; Ref. 37). PCR was carried out in 30 cycles of 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 2 min. PCR products were size
fractionated by agarose gel electrophoresis and visualized by ethidium
bromide staining. To authenticate the fidelity of PCR amplification,
PCR products were subjected to direct sequencing using an automated
ABI377 DNA sequencer (Applied Biosystems, Foster City, CA).
Parallel PCR experiments were also conducted for -actin as a system
control. The primer pairs used were ATCATGTTTGAGACCTTCAACAC and
caggaggagcaatgatcttg (GenBankTM accession nos. M10278 and 5016088),
and PCR was carried out as described above.
| |
RESULTS |
Trans-activation of the CD28 -INR Is Inhibited by Mutations
in Site --
The CD28 INR consists of two contiguous but
noncompeting sequence motifs, and , which have no homology with
the consensus INR and other regulatory elements (10, 24, 25). These
sequences function as a unit; neither nor alone has the ability
to activate transcription of INR-driven DNA templates (18). Moreover,
mutations in either motif result in the complete loss of motif-specific DNA·protein complex formation and effectively inactivate the CD28 gene minimal promoter as determined by reporter gene bioassays (10). To
ascertain further the relative contribution of either site or site
in the activity of the -INR, the previously described mutated
sequences M3, M4, M9, and M10 were introduced in DNA templates and used
in transcription assays. As shown in Fig.
1, all of these mutants blocked
INR-driven transcriptional activity, which was consistent with the
results of reporter assays (10). Clearly, mutations in either or
motif were sufficient to inactivate INR, further supporting the
idea of a structurally bipartite but functionally singular regulatory
element (18).
View larger version (50K):
[in this window]
[in a new window]
|
Fig. 1.
Trans-activation of the CD28
-INR is inhibited by mutations in
site . INR-driven DNA templates (22) containing the wild
type (WT) or mutated variants of site (M3 and M4) and
(M9 and M10) of the CD28 -INR (10) were generated and used in
in vitro transcription assays (18) with crude nuclear
extracts from Jurkat T cells. Sequences of sites and of the INR
and its mutated variants were as indicated. The radiogram shown is
representative of three experiments that were performed in duplicate
reactions as depicted.
|
|
We have reported that the -INR is inoperative in
CD28null T cells because of the coordinate lack of - and
-specific transcription factors (18). Whether such cells were
in vivo derived, such as those isolated from patients with
rheumatoid arthritis or from healthy elderly donors (18, 20), or were
generated in vitro from a CD28+ precursor (38),
a CD28null T cell phenotype was directly correlated with
the complete lack of -/-bound complexes. In the present work, we
identified component proteins of the transcription complex which
specifically bind site and assessed their role in the activity of
the -INR.
Purification of CD28 INR Site -Binding Proteins--
To isolate
the CD28 INR-specific proteins, nuclear extracts from Jurkat, a
prototypical CD28+ T cell line (18), were cleared in a
series of agarose columns, beginning with immobilized DNA, followed by
heparin and strepavidin. The flow-through from the last adsorption
column was subsequently poured into an affinity column consisting of a
double-stranded oligonucleotide, corresponding to the site sequence
of the CD28 INR (10), immobilized in a biotin-strepavidin-agarose
matrix. DNA-bound proteins were eluted by a high salt solution.
Retention of the site -specific complexes during column
chromatography was monitored by EMSA. As shown in Fig.
2A, this chromatographic strategy enabled the efficient retention and subsequent affinity purification of the relevant DNA-binding proteins. Because the functional CD28 INR consists of two distinct protein binding subsites, and (10, 18), DNA binding specificity of the eluted proteins was also confirmed by reciprocal competitive EMSAs using and oligonucleotide probes (data not shown). Such assays showed no
cross-reactivity between the probes as expected.
View larger version (53K):
[in this window]
[in a new window]
|
Fig. 2.
Purification of CD28 INR-binding
proteins. Nuclear extracts from 75-liter cultures of Jurkat cells
were prepared and subjected to oligonucleotide affinity chromatography
using double-stranded wild type (A) or mutated
(B) site sequences (10). The presence of
-INR-binding proteins was monitored during each stage of
purification by EMSAs using oligonucleotide probes corresponding to
site of the CD28 -INR. DNA·protein complexes were
fractionated by nondenaturing PAGE and visualized by autoradiography.
The basis for the design of the affinity purification strategy is
described under "Experimental Procedures." Empirical studies using
affinity columns made up of mutated variant of site (M3) showed a
total lack of column-bound proteins as determined by SDS-PAGE and
silver staining and by MALDI-MS (data not shown). a, crude
extract; b, DNA/heparin column-adsorbed; c,
strepavidin agarose-adsorbed; d, affinity column eluate;
e, affinity column flow-through.
|
|
In empirical experiments, incubation of precleared extracts with excess
amounts of soluble wild type site oligonucleotide sequences prior
to the affinity column purification resulted in a lack of column-bound
proteins as confirmed by lack of signals in EMSA and in silver stained
SDS-polyacrylamide gels (data not shown).
Chromatographic purification of the CD28 INR site -binding proteins
was carried out in three experiments with different batches of nuclear
extracts prepared from 75-liter Jurkat cell cultures each. The average
yield of DNA affinity column-isolated site -binding proteins was
0.03% (
130 µg) of the starting dialyzed nuclear extracts (450 mg).
Similar experiments were conducted using affinity columns consisting of
the M3 mutated variant of site . This mutant was chosen because it
was the strongest inhibitor of CD28 promoter activity in reporter gene
bioassays but does not compete with wild type site sequences in DNA
binding experiments (10). As depicted in Fig. 2B, DNA
affinity chromatography experiments using M3 sequences showed a
complete lack of proteins that specifically recognize site . The
high salt wash from these M3 columns did not contain significant
amounts of protein as determined by spectrophotometric assays, silver
staining of SDS-PAGE gels (data not shown), or by MALDI-MS (below).
Identification of Site -Binding Proteins--
Because the
analyte amounts from the affinity column (Fig. 2A) were
limited, we opted to use MS and MS/MS rather than Edman sequencing to
identify the bound proteins. Initially, the eluates were subjected to
MALDI-TOF-MS to determine the variety and molecular mass of the
constituent components. This analysis invariably afforded two distinct
protonated molecular ions (MH+) at 75 kDa and 45 kDa
(data not shown). Similar MALDI-MS assays of the affinity column
flow-through prior to nuclear extract binding or of washes after the
salt elution of the affinity column-bound proteins showed no detectable
protein ions. Additionally, salt elution from affinity columns of the
M3 variant of site (Fig. 2B) did not yield any
column-bound protein as determined by MALDI-MS.
Subsequently, the wild type site affinity column eluates containing
the 75- and 45-kDa components were individually digested with trypsin,
preconcentrated on a membrane cartridge, and analyzed by nLC-MS/MS as
described elsewhere (26). In the case of the 75-kDa protein, two
product ion spectra are shown in Fig.
3A. Product ions from tryptic
peptides at m/z 781.47 (M+2H) and
m/z 734.10 (M+3H) revealed clear sequence ions of
GFGFVDFNSEEDAK and SEDTTEETLKESFD, respectively. Interrogation of the
protein data base showed that such peptides were from nucleolin.
Similarly, the product ion spectra from the tryptic digest of the
45-kDa protein (Fig. 3B) revealed partial sequence data of
VESIELPMDNK (m/z 811.80 (M+2H)2+) and
FGEVVD (m/z 584.57 (M+3H)3+).
Subsequent data base search returned that these peptides were from
hnRNP-D0.
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
Two proteins are major components of the site
-bound complexes. Affinity-purified site -binding proteins
were digested with trypsin and subjected to scale LC ESI-MS/MS
Q-TOF analysis. Accurate peptide masses and/or partial peptide sequence
information were used in data base searches using MS-Fit or Mascot
search programs. Data shown are sample peptide fragmentation
fingerprints of site -binding proteins, which fit those of nucleolin
and hnRNP-D0. The fragmentation spectra of nucleolin peptides shown
(A) were derived from ion m/z 781.47 ((M+2H)2+) and ion m/z 734.1 ((M+3H)3+) for the upper and lower
panels, respectively. Peptide ion spectra of hnRNP-D0 peptides
shown (B) were derived from ion m/z
811.8 ((M+2H)2+) and ion m/z 584.37 ((M+3H)3+) for the upper and lower
panels, respectively. Peptide sequences indicated are in standard
nomenclature at C- to N-terminal orientation.
|
|
Results showed that peptide fingerprints of nucleolin and hnRNP-D0
appeared to be the most common, comprising about 70% of the total
number of peptides analyzed. These nucleolin and hnRNP-D0 peptide
fingerprints were consistently found in three affinity column eluates
analyzed independently.
Nucleolin and hnRNP-D0A Are Components of the CD28 INR Site
-Bound Complex--
To verify that nucleolin, also referred to as
C23 nucleolar phosphoprotein (27), and hnRNP-D0 are components of site
-binding complexes, EMSAs were performed in the presence of specific
antibody. The monoclonal antibody to nucleolin, MS3 (27), was tested. Results showed that addition of this antibody in the DNA binding reactions did not result in band supershifts but was found to inhibit
DNA·protein complex formation. As shown in Fig.
4, band shifts of site binding
reactions in the presence of MS3 were reduced markedly compared with
those containing an IgG isotype control. Regardless of whether the
antibodies were added before or after the addition of the
oligonucleotide probe to the reactions, MS3 was found to inhibit
specific DNA·protein complex formation. These results were
reproducible in five independent experiments with two dilutions of the
antibody as indicated.
View larger version (67K):
[in this window]
[in a new window]
|
Fig. 4.
Site binding
activity is inhibited by anti-nucleolin antibody. An EMSA for site
-specific binding activity (as in Fig. 2) was performed in the
presence of the anti-nucleolin monoclonal antibody MS3 at the indicated
dilution factors (10, 100) or with an IgG isotype control.
DNA·protein complexes were fractionated by nondenaturing PAGE and
visualized by autoradiography. The radiogram shown is representative of
five independent experiments.
|
|
Similar EMSAs were also conducted in the presence of anti-hnRNP-D0
antibodies. In these assays, four antisera were examined. These
antisera were generated against peptides corresponding to either exon 2 or exon 7, which determines the isoforms of hnRNP-D0 (30, 37, 39) as
illustrated in Fig. 5A. These
exon-specific antisera have been described previously (28, 29). On the
one hand, the P1 and P2 antisera were exon 2 region-specific; P1 was specific for exon 2 itself, whereas P2 was directed to a sequence immediately flanking 3' of exon 2. On the other hand, the P3 and P4
antisera were exon 7-specific; P4 specificity was exon 7 itself, and P3
specificity was the junction of exons 6 and 7.
View larger version (41K):
[in this window]
[in a new window]
|
Fig. 5.
Site binding
activity is inhibited by antibodies to the A isoform of hnRNP-D0.
A, the isoforms of hnRNP-D0 are identified by the presence
or absence of exon 2 or exon 7 (28, 29, 36) as indicated.
RRM, RNA binding motif. B, an EMSA (as in Fig. 2)
was performed in the presence of a 1/100 dilution of rabbit antisera to
hnRNP-D0 or a preimmune serum control (Pre). The antisera
were specific to either exon 2 (P1), the 3'-flank of exon 2 (P2), or
exon 7 (P3, P4), as indicated (29). The radiogram shown is
representative of six independent experiments.
|
|
As in EMSAs with anti-nucleolin antibodies, the addition of
anti-hnRNP-D0 rabbit antisera to the binding reactions did not result
in band supershifts. As shown in Fig. 5B, however, antisera to exon 7 (P3, P4), but not exon 2 region (P1, P2), inhibited site
-protein complex formation. This suggested that the A isoform of
hnRNP-D0, which contains exon 7 but not exon 2, was a component of the
site -binding complexes. As expected, the addition of preimmune
rabbit serum to the binding reactions had no effect on site binding
activities. These results were reproducible in six independent
experiments. Whether the antisera were added before or after the
oligonucleotide probe, only the antisera to exon 7 were found to
inhibit site binding activity.
EMSAs were also conducted with different combinations of anti-nucleolin
and anti-hnRNP-D0 antibodies. In these experiments, however, the
presence of both antibodies did not totally abrogate site binding
activities (data not shown). Although MS3 or P3 or P4 alone was
consistently found to reduce specific band shift signals markedly,
combinations of antibodies did not eliminate the residual band shifts
seen in reactions with a single antibody (as depicted in Figs. 4 and
5B).
Nucleolin and hnRNP-D0A Play a Role in the Trans-activation of the
CD28 -INR--
To assess the role of nucleolin and hnRNP-D0A in
the activity of the -INR, transcription assays were conducted
using INR-driven DNA templates (18). In these assays, nuclear extracts
were initially depleted of nucleolin or hnRNP-D0A with specific
antibody and then added to in vitro transcription reactions.
Depletion of nucleolin or hnRNP-D0A was verified by Western blotting
(data not shown), which showed the absence of the protein in the
antibody-adsorbed extracts.
As depicted in Fig. 6A,
immunodepletion of nucleolin with the MS3 anti-nucleolin antibody
resulted in the significant reduction in the levels of
-INR-dependent transcription. Immunodepletion of
nucleolin from nuclear extracts with MS3 resulted in the pronounced reduction or complete abrogation of specific transcripts of -INR DNA templates.
View larger version (66K):
[in this window]
[in a new window]
|
Fig. 6.
Trans-activation of CD28
-INR-driven DNA templates requires
nucleolin. A, nuclear extracts were adsorbed with
anti-nucleolin antibody (MS3) or IgG isotype control and used in
transcription assays with CD28 -INR-driven DNA templates (as in
Fig. 1). As a system control, similar assays were conducted using
similar DNA templates under the control of the wild type
(wt) or mutated variant (mt) of the TdT INR (18,
22). The radiogram shown is representative of two experiments, which
consisted of three separate reactions for each of the antibody-adsorbed
nuclear extracts. B, similar transcription assays of CD28
-INR-driven templates were conducted using nucleolin-depleted (as
in A) and nucleolin-reconstituted nuclear extracts.
Reconstitution was achieved by the addition of proteins eluted from
anti-nucleolin (MS3) matrices to the transcription reactions. The
radiogram shown is representative of two experiments.
|
|
Similarly, in vitro transcription assays with nuclear
extracts adsorbed with anti-hnRNP-D0A rabbit antisera showed a marked reduction in CD28 -INR-dependent transcription. As
shown in Fig. 7A, extracts
cleared with P3 or P4 anti-hnRNP-D0 exon 7 antiserum (refer to Fig. 5)
yielded significantly lower amounts of specific transcripts compared
with control extracts or those cleared with preimmune serum. The levels
of antisera-dependent reduction of transcripts were
equivalent between P3 and P4. Transcription assays with nuclear
extracts cleared with P1 anti-hnRNP-D0 exon 2 antiserum (Fig.
7B) had no effect on the transcriptional activity of the DNA
templates.
View larger version (80K):
[in this window]
[in a new window]
|
Fig. 7.
Trans-activation of CD28
-INR-driven DNA templates requires
hnRNP-D0A. A, nuclear extracts were adsorbed with
anti-hnRNP-D0A antisera (P3, P4) or a preimmune serum control
(Pre) and then used in in vitro transcription
assays (as in Fig. 6) with DNA templates controlled either by the CD28
-INR or the wild type (wt) or mutated variant
(mt) of TdT INR. The radiogram shown is representative of
four experiments, which consisted of two separate reactions for each of
the antibody-adsorbed nuclear extracts. B, similar
transcription assays of CD28 -INR-driven templates were conducted
using hnRNP-D0-depleted (as in A) and hnRNP-D0-reconstituted
nuclear extracts. Reconstitution was achieved by the addition of
proteins eluted from anti-hnRNP-D0B (P1) or anti-hnRNP-D0A (P3, P4)
matrices to the transcription reactions. The radiogram shown is
representative of two experiments.
|
|
The role of nucleolin and hnRNP-D0A in the trans-activation
of the CD28 -INR was verified further in reconstitution
experiments (Figs. 6B and 7B). Although
immunodepletion of these proteins abrogated transcription of INR-driven
templates, addition of the immunoprecipitates back into the
transcription reactions resulted in the reconstitution of
transcriptional activity.
The role of nucleolin and hnRNP-D0A as transcriptional activators was
specific for -INR but not for classical INRs such as that of TdT
(34, 40). Results of these experiments (Figs. 6A and
7A) also showed that the immunodepletion of either nucleolin or hnRNP-D0A did not affect the transcriptional activities of TdT
INR-driven DNA templates. As expected, DNA templates containing the
mutated variant of TdT-INR showed negligible amounts of transcripts regardless of the nuclear extract used in the transcription assays.
CD28 INR Site -Specific Complexes Are Distinct from Other
Nucleolin- and hnRNP-D0-containing DNA·Protein
Complexes--
Nucleolin and the B isoform of hnRNP-D0 have been
reported previously to bind DNA regulatory sequences. In particular,
nucleolin·hnRNP-D0B has been found to comprise a B cell-specific
transcription factor LR1, which specifically binds to Ig switch region
sequences (30, 31). Additionally, hnRNP-D0B, by itself, has also been
reported to bind an enhancer element in the CR2 gene promoter in B
cells (28, 32). Hence, we examined whether these sequences had
overlapping protein- binding activities with the CD28 INR site sequence (10, 20).
Competitive EMSAs were therefore performed. As expected, excess amounts
of unlabeled site sequences effectively out-competed the
radiolabeled site oligonucleotide probes as shown in Fig. 8A. In contrast, neither the
M3 variant of site , the LR1-specific Ig switch region sequence, nor
the CR2 sequence was an effective competitor of the site binding
probes. At 300 molar excess of each competitor, site -bound complex
formation was unperturbed.
View larger version (55K):
[in this window]
[in a new window]
|
Fig. 8.
DNA sequence motifs recognized by
hnRNP-D0B·nucleolin complexes do not inhibit site binding activity. A, EMSA (as in Fig. 2) was
performed using CD28-INR site sequences as the binding probe in the
presence of excess amounts of unlabeled competitor double-stranded
oligonucleotides as indicated. Such competitors were the Ig switch
region sequence recognized by LR1 (B cell-specific transcription factor
comprising a nucleolin·hnRNP-D0B complex) (30, 31), the hnRNP-D0B
binding motif in the CR2 gene (28, 29), or the M3 mutant variant of the
CD28-INR site (10). The radiogram shown is representative of three
independent experiments. B, EMSA was also conducted using
site , M3, LR1, and CR2 sequences as binding probes for Jurkat T
cell nuclear extracts. The radiogram shown is representative of three
experiments. C, nuclear extracts were incubated with a 100 molar excess of double-stranded site , M3, LR1, or CR2
oligonucleotides and subsequently used in transcription assays (as in
Fig. 1) with CD28 -INR-driven DNA templates. As a system control,
similar assays were conducted with templates under the control of
either the wild type (wt) or mutated variant (mt)
of the TdT INR. The radiogram show is representative of two
experiments.
|
|
Consistent with the reported B cell-specific binding activities of LR1
(30, 31) and CR2 (28, 32), DNA binding assays using these sequences as
binding probes for Jurkat T cell nuclear extracts did not demonstrate
significant protein binding activities as shown in Fig. 8B.
As expected, the M3 mutated variant of site also lacked protein
binding activity.
To assess further that DNA·protein complex formation with site sequences is distinct from that reported for LR1 and CR2 sequences (28,
30, 31), transcription assays were conducted using Jurkat T cell
nuclear extracts that were preincubated with these sequences. As shown
in Fig. 8C, incubation of extracts in excess amounts of
synthetic double-stranded LR1 or CR2 oligonucleotides did not affect
the transcription of CD28 -INR-driven DNA templates. In contrast,
incubation of the extracts in wild type site oligonucleotides effectively blocked -INR-dependent transcription. As
expected, the M3 mutant variant of site did not block
transcription. The transcriptional activity of TdT INR-driven templates
were unaffected by the preincubation of the extracts in the site ,
LR1, or CR2 sequences.
Because nucleolin and hnRNP-D0 proteins are known to bind RNA sequences
(36, 37, 41, 42), experiments were conducted to examine whether site
binding activities can be achieved with single-stranded DNA
sequences. As shown in Fig. 9, neither
sense nor antisense site oligonucleotides showed significant
protein binding activities. This was in marked contrast with high
levels of DNA·protein complexes found with double-stranded site sequences.
View larger version (67K):
[in this window]
[in a new window]
|
Fig. 9.
Site binding
activity is restricted to double-stranded DNA. EMSAs (as in Fig.
2) were conducted in duplicate reactions using double-stranded
(ds) or single-stranded (ss) DNA probes
corresponding to site of the CD28-INR in the presence (+) or
absence () of nuclear extracts from CD28+ T cells. The
radiograms shown are representative of four experiments.
|
|
Preferential Formation of Nucleolin·hnRNP-D0A·Site Complexes in CD28+, but Not CD28null, T
Cells--
To examine whether the differential expression of site
-binding complexes between CD28+ and
CD28null T cells (18, 20) could be attributed to the
presence or absence of nucleolin and hnRNP-D0A, Western blotting
experiments were conducted. As shown in Fig.
10A, nucleolin was found in
the nuclear extracts of both CD28+ and CD28null
T cells. The relative levels of expression of nucleolin, as detected by
the MS3 antibody, were equivalent in at least two transformed T cell
lines (Jurkat and HUT78), two primary T cell lines (H28P and H28N), and
two T cell clones (PL65 and K2) examined. Regardless of the CD28
phenotype of the cell, nuclear nucleolin was detected as a single
protein band of 105 kDa. Consistent with previous reports (41, 42),
this apparent molecular mass of nucleolin was significantly larger than
the predicted size of 76.3 kDa based on the amino acid sequence. Such
an increase in the molecular mass had been attributed to
post-transcriptional modification of the protein (43). Parenthetically,
the MS3 antibody had been shown previously to recognize nucleolin with
apparent molecular masses between 100 and 120 kDa (27).
View larger version (43K):
[in this window]
[in a new window]
|
Fig. 10.
Nucleolin and hnRNP-D0A are expressed in
both CD28+ and CD28null T cells.
A, crude nuclear extracts (10 µg) from CD28+
(Jurkat, PL65, H28P) and CD28null (HUT78, K2, H28N) T cells
were prepared and used in Western blotting experiments. Nucleolin was
detected by the MS3 antibody (27), and hnRNP-D0A was detected by the P4
antiserum (29). Data shown are representative of three experiments.
B, total RNA was isolated from CD28+ and
CD28null T cells as indicated and subjected to RT-PCR
experiments using amplification primers specific for exon 7 of
hnRNP-D0A. Similar experiments were also conducted using primers for
-actin, a housekeeping gene. Exon 7 and -actin PCR products were
fractionated in 1.5% and 0.8% agarose gels, respectively, and
visualized by ethidium bromide staining. Data shown are representative
of three experiments.
|
|
Like nucleolin, hnRNP-D0A was expressed in all of the T cells examined
as shown in Fig. 10A. Regardless of the expression of CD28,
hnRNP-D0A, as detected by the P4 antiserum (29), was found as a single
protein band of 45 kDa, which corresponded with the predicted
molecular mass of hnRNP-D0A (29, 36). The relative levels of its
expression were equivalent among all of the cells examined.
The pattern of hnRNP-D0A expression among the different T cells
examined was recapitulated in RT-PCR assays as depicted in Fig.
10B. There was a relative abundance of transcripts
containing exon 7 sequences, which were characteristic of hnRNP-D0A
(37). Direct DNA sequencing (data not shown) confirmed the authenticity of the PCR-amplified products.
Although nucleolin and hnRNP-D0A were expressed in both
CD28+ and CD28null T cells, a complex of these
proteins that recognized the CD28 INR site was found only in
CD28+ cells. Using a combination of modified EMSA using
biotinylated binding probes in concert with Western blotting of
DNA·protein complexes isolated by strepavidin-agarose pulldown assay,
nucleolin was found to be indeed a component of the site -bound
complex as shown in Fig.
11A. With nuclear extracts
from CD28+ Jurkat T cells, this experimental strategy
showed a single protein band recognized by the anti-nucleolin antibody
MS3 both in the nuclear extract and in the isolated site -bound
complex. A residual amount of MS3-reactive proteins was also found in
the supernatants of the EMSA binding reaction from which the site
-bound complexes were isolated. In contrast, similar experiments
using nuclear extracts from CD28null HUT78 T cells showed
MS3-reactive proteins only in the whole extract and in the supernatant
of the EMSA binding reaction.
View larger version (38K):
[in this window]
[in a new window]
|
Fig. 11.
Nucleolin·hnRNP-D0A·site
-complex formation is permissible in
CD28+ but not in CD28null T cells. Jurkat
and HUT78 nuclear extracts (100 µg) were precleared in
strepavidin-agarose and added to an EMSA binding reaction containing
biotinylated site sequences as the binding probe. DNA·protein
complexes were isolated by strepavidin-agarose. An aliquot of the
precleared nuclear extracts (lane a), the isolated DNA-bound
fraction (lane b), and an aliquot of the remaining
supernatant of the binding reaction (lane c) were subjected
to SDS-PAGE and Western blotting. The presence of nucleolin
(A) was detected by the MS3 antibody (27), and hnRNP-D0A
(B) was detected by the P4 antiserum (29). As system
control, immunoblotting for the RNA-binding protein hnRNP-A1 (35) was
also carried out using the 4B10 antibody (C). Data shown are
representative of two experiments.
|
|
From the identical samples of whole extracts, the site -bound
complexes, and the supernatants of the DNA binding reactions, the
presence of hnRNP-D0A was also examined. As depicted in Fig. 11B, samples from experiments using Jurkat nuclear extracts
showed a single protein band recognized by the P4 antiserum to
hnRNP-D0A. Similar samples from experiments with HUT78 nuclear extracts
also showed the presence of P4-reactive proteins in the whole extracts and in the supernatants of the DNA binding reactions, but not in the
isolated site -bound complex.
Because nucleolin and hnRNP-D0A belong to a superfamily of structurally
and functionally homologous proteins (36, 41), the identical samples
were also analyzed for the presence on hnRNP-A1, the most abundant of
the hnRNP proteins (36). Using the monoclonal 4B10 antibody specific
for hnRNP-A1 (35), immunoblotting experiments showed the relative
abundance of 4B10-reactive proteins in the whole extracts of Jurkat and
HUT78 as depicted in Fig. 11C. Such 4B10-reactive proteins
were also present in the supernatants of the DNA binding reactions.
However, there was a complete lack of 4B10-reactive proteins in the
isolated site -bound complexes, particularly from those samples
isolated from binding reactions with Jurkat extracts, which contained
nucleolin·hnRNP-D0A complexes (Fig. 11, A and
B).
| |
DISCUSSION |
The present work shows that CD28 -INR function is regulated,
at least in part, by a protein complex that includes nucleolin and
hnRNP-D0A. Because these molecules are ubiquitous mammalian proteins
(36, 43), their binding specificity for the 5'-site sequence of the
INR of CD28 is rather surprising and impressive. The finding that
nucleolin and hnRNP-D0A peptide ions (Fig. 3) comprise 70% of the
total peptides analyzed indicates that these proteins are key
components of the site -specific complex. Peptide fingerprints of
these proteins were found reproducibly in three independent DNA
affinity chromatography-MS/MS experiments. Such peptides were absent
from analytes obtained from affinity matrices comprising mutated site
sequences (data not shown).
The notion that nucleolin·hnRNP-D0A complexes are site -specific
is supported further by several observations. First, specific antibodies to either protein perturb DNA binding (Figs. 4 and 5).
Second, isolated site -bound complexes are immunoreactive to both
anti-nucleolin and anti-hnRNP-D0A antibodies (Fig. 11, A and
B). More importantly, these DNA·protein complexes do not contain other ubiquitous proteins such as hnRNP-A1 (Fig.
11C), which are structurally and functionally homologous to
both nucleolin and hnRNP-D0A (35, 36). And third, immunodepletion of
either protein in transcription reactions effectively blocks the
production of transcripts of -INR-driven DNA templates (Figs.
6A and 7A). Additionally, reconstitution of
-INR-driven transcription by the addition of specific
immunoprecipitates (Figs. 6B and 7B) provides
evidence that nucleolin and hnRNP-D0A play a role in the
trans-activation of the CD28 INR. Collectively, these
findings also provide further evidence that INR activity can be
attributed to transcription factors other than the general
transcription factors or the components of transcription factor IID
(22, 44-46).
Nucleolin and members of the hnRNP family are known for their RNA
binding properties, which accounts for their various roles in RNA
metabolism including translation and RNA shuttling between the nucleus
and the cytoplasm (36, 41). However, there is increasing evidence that
they bind DNA and serve as specific transcriptional regulators: hnRNP-K
has been found to be a general transcription factor that interacts with
transcription factor IID (47), and the B isoform of hnRNP-D0 has been
reported to be specific regulator of CR2 gene expression in B cells
(32). Interestingly, hnRNP-D0B in complex with nucleolin has been found
to comprise a B cell-specific transcription factor that recognizes Ig
switch region sequences (30, 31). Thus, our finding that nucleolin and
the A isoform of hnRNP-D0 form a transcription factor complex (Fig. 11,
A and B) that participates in the activation of
the CD28 INR (Figs. 6 and 7) provides yet another evidence that these
proteins have indeed, broad functions including the regulation of DNA transcription.
Considering that CD28 is a T cell-restricted molecule (2) and that Ig
class switching is B cell-restricted (48), the findings that nucleolin
and the A and B isoforms of hnRNP-D0 are regulators of gene expression
(Figs. 6 and 7; Refs. 30 and 31) point to an emerging biological
concept that common proteins also regulate cell-specific functions.
Because gene expression involves the cooperative interaction of
proteins, it may be argued that the transcriptional activity of
ubiquitous nuclear proteins could be a result of a functional
conformation of particular protein-protein interactions. Differences in
the combinatorial outcomes of such ubiquitous proteins could account
for their cell-specific functions. This view is supported by the
finding CD28 INR site does not cross-compete with the Ig switch
sequence LR1 or the CR2 sequence (Fig. 8) despite the fact that these
DNA sequences bind very similar protein complexes. Although the LR1
sequence is recognized by nucleolin in complex with the B isoform of
hnRNP-D0 (30, 31), the site sequence is specifically recognized by
nucleolin in complex with the A isoform of hnRNP-D0 (Figs. 3-8).
Nucleolin·hnRNP-D0A complex likely recognizes double-stranded site
sequences (Fig. 9), which is in marked contrast to
nucleolin·hnRNP-D0B binding to unwound single-stranded LR1 sequences
(30) or to known RNA binding activities of nucleolin and hnRNP-D (36,
37, 41).
Nucleolin and hnRNP-D0A are found in both CD28+ and
CD28null T cells as detected by Western blots and in RT-PCR
experiments (Fig. 10). However, nucleolin·hnRNP-D0A complexes capable
of binding site sequences are found only in CD28+, but
not CD28null, T cells (Fig. 11), suggesting that activity
of the CD28 INR is not attributable to the presence or absence of these
proteins but to the formation of a functionally active DNA binding
complex. A key issue therefore is the basis for their preferential
complex formation with the INR site sequence in CD28+ T
cells (10, 18, 20). Because nucleolin and hnRNPs are modular proteins
whose biological functions are regulated by post-transcriptional modifications (36, 37, 41, 42), it is possible that site complex
formation is dependent on such modifications. We have preliminary data
showing that phosphorylation contributes to site complex
formation.2 In particular,
phosphorylation on serines and threonines appears to be more critical
to complex formation than phosphorylation of tyrosines. Although the
exact positions of phosphorylated amino acid residues on nucleolin
and/or hnRNP-D0A remain to be examined, this finding supports the
notion that differential combinatorial outcomes of protein-protein
interactions may well provide the basis for the differential assembly
of a nucleolin·hnRNP-D0A complex on the CD28 INR site .
Although the present data point to a key role of nucleolin and
hnRNP-D0A in CD28 expression, the role of another protein in the
preferential site -complex formation in CD28+ T cells,
however, cannot be ruled out. This is indicated by the observation that
nucleolin and hnRNP-D0A peptides comprise only 70% of the
fragmentation ions of site -bound complexes (Fig. 3). The possible
role of yet undefined protein(s) is also suggested by the observed
residual site binding activities in the presence of inhibitory
antibodies (Figs. 4 and 5) and by the low but detectable -INR-dependent transcription with nuclear extracts
depleted of nucleolin and hnRNP-D0A (Figs. 6 and 7).
Previous studies have indicated that CD28 transcription may also
be regulated by Sp1 and Egr-1 proteins, which bind to a so-called GR element situated in the first exon of the gene (49). The GR
sequence is likely an enhancer element as evidenced by observations that the pharmacologic agent phytohemagglutinin increases the activity
of GR-driven reporter gene constructs. It may be noted that the GR
element is 30-bp upstream from the first translation codon (49),
whereas the -INR is situated 130-bp further upstream in the
5'-untranslated region (10) and coincides with the transcription initiation site (50). Unlike the enhancer activity of the GR sequence,
the -INR is a core promoter element regulating the constitutive
transcription of CD28 (18). As shown in the present work (Figs. 1, 6,
7, and 8C), -INR clearly functions as an initiator that regulates transcription of a heterologous DNA template even in the
absence of GR sequences. Whether or not productive transcription of
CD28 in vivo involves the interaction of Sp-1/Egr-1/GR and the nucleolin·hnRNP-D0A·site complexes remains to be examined.
In summary, data presented here show that nucleolin and hnRNP-D0A
are part of a transcription factor complex that binds to the site of the CD28 INR and participates in the initiation of specific
transcription through the INR core p
§,
**,
TOP
ABSTRACT
INTRODUCTION
