Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M604317200 on June 19, 2006

J. Biol. Chem., Vol. 281, Issue 33, 23445-23455, August 18, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
281/33/23445    most recent
M604317200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takata, K.-i.
Right arrow Articles by Wood, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takata, K.-i.
Right arrow Articles by Wood, R. D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Human DNA Polymerase N (POLN) Is a Low Fidelity Enzyme Capable of Error-free Bypass of 5S-Thymine Glycol*

Kei-ichi Takata{ddagger}, Tatsuhiko Shimizu§, Shigenori Iwai§, and Richard D. Wood{ddagger}1

From the {ddagger}Department of Pharmacology, Hillman Cancer Center, University of Pittsburgh Medical School, Pittsburgh, Pennsylvania 15213-1863 and the §Division of Chemistry, Graduate School of Engineering Science, Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531, Japan

Received for publication, May 5, 2006 , and in revised form, June 14, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Human DNA polymerase N (POLN or pol {nu}) is the most recently discovered nuclear DNA polymerase in the human genome. It is an A-family DNA polymerase related to Escherichia coli pol I, human POLQ, and Drosophila Mus308. We report the first purification of the recombinant enzyme and examination of its biochemical properties, as a step toward understanding the functions of POLN. Unusual for an A-family DNA polymerase, POLN is a low fidelity enzyme incorporating T opposite template G with a frequency of 0.45 and G opposite template T with a frequency of 0.021. The frequency of misincorporation of T opposite template G is higher than any other known DNA polymerase. POLN has a processivity of DNA synthesis (1–100 nucleotides) similar to the exonuclease-deficient Klenow fragment of E. coli pol I, is inhibited by dideoxynucleotides, and resistant to aphidicolin. The strand displacement activity of POLN was higher than exonuclease-deficient Klenow fragment. Furthermore, POLN can perform translesion synthesis past thymine glycol, a common endogenous and radiation-induced product of reactive oxygen species damage to DNA. Thymine glycol blocks DNA synthesis by most DNA polymerases, but POLN was particularly adept at efficient and accurate translesion synthesis past a 5S-thymine glycol.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The human genome contains 15 distinct known DNA polymerase genes, and these are classified into four families A, B, X, and Y based on their amino acid sequences (1). Human DNA polymerase N (POLN),2 the most recently discovered nuclear DNA polymerase, is an A-family enzyme with unknown function. The gene on chromosome 4p16.2 encodes a protein of 900 amino acid residues with a molecular mass of 100 kDa (2). The prototypical A-family DNA polymerase, Escherichia coli pol I is a high fidelity DNA polymerase that contributes to the maturation of Okazaki fragments during DNA replication and in gap-filling during base excision repair (BER), nucleotide excision repair (NER), and repair of DNA interstrand cross-links.

Human POLQ, another A-family DNA polymerase, is similar to the Drosophila nuclear DNA polymerase Mus308 (3) in that it encodes both a DNA/RNA helicase domain and an A-family DNA polymerase domain (4, 5). By contrast, POLN has only the DNA polymerase domain. The POLN gene is encoded only in vertebrate genomes, but not in invertebrates or any lower eukaryotes. Possibly POLN has a role related to organ systems that are especially developed in vertebrates, such as the adaptive immune system or the brain. Expression studies of POLN are limited, but expression of the gene has been detected by Northern blotting in testes, heart and skeletal muscle tissue (2) and by expression sequence tagging in prostate, muscle, brain, and other organs. In cells from a human neuroblastoma patient, a chromosome fusion (1, 4) disrupting the DNA polymerase domain coding sequence of POLN was observed at diagnosis and at relapse. A (4, 17) fusion was detected at relapse only (6). It is possible that POLN might serve as a tumor suppressor in some cell types and that loss of its function could accelerate genome instability.

To understand the functions of human POLN, we examined the fidelity and the activity of DNA damage bypass. We find that POLN has very low fidelity and a remarkable insertion preference different from any other known human DNA polymerase. Further, POLN can perform accurate translesion synthesis past a common product of reactive oxygen species damage to DNA, the thymine glycol. The properties of POLN indicate a function distinct from that of POLQ.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Enzyme Purification—To construct a human POLN sequence construct for expression in E. coli, POLN with a short truncation of the C-terminal proline-rich tail was purified. This enzyme, previously referred to as POLN {Delta}P (2) shows no difference in activity from full-length POLN and is the same length as rodent POLN. This POLN and the corresponding D623A mutant were amplified by PCR from the plasmid pEGFP-C1 containing full-length wild type or D623A mutant POLN (2) using the primers 5'-CACCGAAAATTATGAGGCATTGGTAGGC-3' (for the 5'-end) and 5'-ATATATGAATTCCTACTTGTCGTCATCGTCTTTGTAGTCCATGCCCCAGGCCTCCTGCAGTGGCACC-3' (for the 3'-end), and cloned into plasmid pENTR/D-TOPO (Invitrogen). After DNA sequencing, the cDNA was transferred into plasmid pDEST17 (Invitrogen) resulting in a protein tagged with six His residues at the N terminus (contributed by the pDEST17 vector), and a FLAG tag at the C terminus. The plasmid was transformed into an E. coli strain BL21 star (DE3), mutated for RNaseE (Invitrogen) and containing a plasmid (pRARE, Novagen) encoding 7 tRNAs for rare codons and the lysS+ gene. A single colony was incubated in 25 ml of Luria-Bertani medium (LB) containing 40 mM glucose, 50 µg/ml carbenicillin, and 50 µg/ml chloramphenicol at 37 °C. The culture was grown overnight and transferred into 500 ml of fresh LB containing 40 mM glucose, 50 µg/ml carbenicillin, and 50 µg/ml chloramphenicol. The culture was grown at 37 °C to an optical density at 600 nm of 0.5 and cooled down on ice for 30 min. The culture was incubated with 1 mM isopropyl-beta-D-thiogalactopyranoside at 16 °C for 16 h. Incubation at 16 °C improved soluble protein expression relative to incubation at 37 °C. Cells were harvested by centrifugation (3000 x g for 10 min) and washed with ice-cold phosphate-buffered saline. After centrifugation (3000 x g for 10 min), 10 volumes of FLAG binding buffer (100 mM sodium phosphate pH 7.6, 10% glycerol, 5 mM EDTA, 0.1% Triton X-100, 0.1 mg/ml BSA, 100 nM desferrioxamine, and EDTA-free protease inhibitor mixture from Roche Applied Science was added to the pellet. The resuspended mixture was sonicated on ice (20 cycles of 10 s with a 20 s pause), and 0.25% polyethyleneimine was added and incubated for 15 min at 4 °C. DNA and debris were removed by centrifugation (15,000 x g for 15 min) and the supernatant incubated overnight at 4 °C with 200 µl of FLAG resin (Sigma). The resin was washed five times with 10 volumes of FLAG washing buffer (100 mM sodium phosphate, pH 7.6, 10% glycerol, 0.01% Nonidet P-40, and EDTA-free protease inhibitor mixture) and then three times with 10 volumes of TALON binding buffer (50 mM sodium phosphate, pH 7.0, 300 mM NaCl, 10% glycerol, 0.01% Nonidet P-40, and EDTA-free protease inhibitor mixture). The protein was eluted by incubating with 200 µg/ml FLAG peptide in 500 µl of TALON binding buffer for 1 h at 4 °C. The elution was incubated with 500 µl of TALON resin (BD Biosciences Clontech) for 1 h at 4 °C. The resin was washed five times with 10 volumes of TALON binding buffer and the protein eluted with 1 ml of TALON binding buffer containing 150 mM imidazole. Rabbit polyclonal antibody PA434, raised against an N-terminal 500-amino acid fragment of human POLN produced in E. coli (2) was used for immunoblotting.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 1.
DNA polymerase activity of purified wild-type and mutant recombinant POLN. A, silver-stained gel showing molecular mass markers and 290 ng of purified POLN and POLN (D623A). Proteins were separated by electrophoresis on an SDS 4–15% polyacrylamide gradient gel. B, 290 ng of POLN and POLN (D623A) were loaded onto a gel and immunoblotted with a 1:1000 dilution of POLN antibody (PA434). C, DNA polymerase activity was measured by extension of a 16-mer primer annealed to a 30-mer template. Samples from left to right represent incubation with 23 nM BSA for 10 min, incubation with 23 nM POLN for 0, 2.5, 5.0, and 10 min, and incubation with 23 nM POLN (D623A) for 0, 2.5, 5.0, and 10 min. D, POLN does not possess 3'-5' exonuclease activity. Decreasing amounts of POLN (23 and 5.7 nM in lanes 2 and 3) or E. coli pol I (9.2 and 2.3 pM in lanes 4 and 5) were incubated with the same template but without dNTP for 10 min. Lane 1 contained no enzyme. E, TdT activity of POLN. 23 nM POLN was incubated with 300 fmol of 5'-32P-labeled 14-mer primer annealed to a 14-mer DNA (lanes 1–6) or not annealed (lanes 7–12), in the presence or absence of the indicated dNTPs (100 µM) for 10 min.

 
DNA polymerase Q (POLQ) was as reported (5). RB69 (gp43) was expressed from a plasmid provided by W. Konigsberg and purified as described (7). Human DNA polymerase beta (POLB) was provided by R. Sobol, and human DNA polymerase {eta} (POLH) by C. Masutani and F. Hanaoka. Kf (exo-) and E. coli pol I were obtained from Promega.

Oligonucleotide Substrates—Primer oligonucleotides were purchased from Bio-Synthesis or Sigma GenoSys, purified by HPLC or gel extraction, and 5'-labeled using polynucleotide kinase and [{gamma}-32P]dATP. For 3'-labeling, the oligonucleotides were incubated with terminal deoxynucleotidyl transferase (TdT) and [{alpha}-32P]ddATP. Oligonucleotides containing a single thymine-thymine CPD, thymine-thymine 6–4 photoproduct, or 5S-thymine glycol were synthesized as detailed earlier (8–10). The oligonucleotide containing a 1,2 d(GpG) cisplatin intrastrand adduct was as described (11). The oligonucleotide containing an AP site or 5R-thymine glycol were purchased from Glen Research. 5'-32P-Labeled primers were annealed to these oligonucleotides to create substrates for bypass assays (lesions highlighted by bold letters) as follows: Non-damaged substrate: CACTGACTGTATGATGGTGACTGACATACTACTTCTACGACTGCTC-5'. This substrate was also used for the 3'-5' exonuclease assay. 5'-AAGATGCTGACGAG or 5'-AGATGCTGACGAG were annealed to the non-damaged substrate to create the nicked substrate or single-gapped substrates, respectively. CPD- and (6–4)PP substrate: CACTGACTGTATGATGGTGACTGACATACTACTTCTACGACTGCTC-5'. AP site-substrate (site of the AP-analog denoted by X): CACTGACTGTATGATGGTGACTGACATACTACXTCTACGACTGCTC-5'. Tg-substrate (5S-Tg or 5R-Tg is denoted by Tg): CACTGACTGTATGATGGTGACTGACATACTAC(Tg)TCTACGACTGCTC. 1,2 d(GpG) cisplatin intrastrand adduct substrate: AGAAGAAGAAGGTCTTCTTCTTCCGGATCTTCTTCT-5'.


Figure 2
View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 2.
Biochemical properties of POLN on a poly(dA) template primed with oligo(dT) (10:1). A, aphidicolin resistance of POLN in comparison to E. coli Kf (exo-) pol I and T4 DNA polymerase. B, NEM resistance of POLN in comparison to E. coli Kf (exo-) pol I and T4 DNA polymerase. C, inhibition of POLN by ddNTPs. Reaction mixtures included 10 µM dTTP, the indicated concentrations of ddTTP, and 8 µg/ml poly(dA)/oligo(dT)10:1 template. D, sequence alignment of the motif 4 of A-family DNA polymerases. Dark shading denotes the highly conserved aromatic residue that affects ddNTP sensitivity in bacterial DNA polymerases. The boxed residue (Lys or Arg in POLN, Ala or Thr in high fidelity of bacterial pol I, and Q in POLQ and Mus308) is a major determinant of fidelity in bacterial Pol I; see text for further details. POLN sequences: Hs, human; Ch, chimpanzee; Mm, mouse; Dg, dog; Gl, chicken; Dr, zebrafish Danio rerio. POLQ sequences: Hs, human; Mm, mouse. Mus308, Drosophila melanogaster Mus308; CeMus1, Caenorhabditis elegans Mus1; Myctu, Mycobacterium tuberculosis pol I; EcPolI, E. coli pol I; Haein, Haemophilus influenzae pol I; Ricketts, Rickettsia prowazekii pol I; BstPolI, Bacillus stearothermophilus pol I; TaqPolI, Thermus aquaticus pol I; Trepon, Treponema pallidum pol I.

 
For processivity assays, the 24-mer primer oligonucleotide 5'-[32P]TCTTCTTCTGTGCACTCTTCTTCT was annealed to M13mp18GTGx single-stranded DNA (12). For strand displacement assays, A 60-mer oligonucleotide with either a 5'-phosphoryl or 5'-hydroxyl, 5'-CCCCAGGAATTCGGTCATAGCTGTTTCCTGCTCGAGGGCGCCAGGGTGGTTTTTCTTTTC was annealed together with the 24-mer oligomer to M13mp18GTGx ssDNA.

For assay of TdT activity, the 14-mer oligomer 5'-[32P]AAGATGCTGACGAG was tested as a single strand or annealed to 5'-CTCGTCAGCATCTT as a blunt end duplex.

DNA Polymerase Assays—A 5'-labeled 16-mer primer and a 30-mer template (sequences given above) were annealed at a molar ratio of 1:1 to detect DNA polymerase activity. The oligonucleotides were heated for 5 min at 65 °C and cooled down slowly for self-annealing. Standard reaction mixtures (10 µl) contained 20 mM Tris-HCl pH 8.8, 4% glycerol, 2 mM DTT, 80 µg/ml BSA, 8 mM Mg(C2H3O2)2, 300 fmol of the primer template (30 nM), 100 µM each dNTP, and the indicated amount of POLN. dATP, dTTP, dGTP, and dCTP (100 µM) each were also present unless otherwise indicated. Before the addition of POLN, the reaction mixture was preincubated at 37 °C for 1 min. After incubation at 37 °C for 10 min (unless otherwise indicated), reactions were terminated by adding 10 µl of gel loading buffer (98% deionized formamide, 0.025% xylene cyanol, 0.025% bromphenol blue, and 20 mM EDTA) and boiling at 95 °C for 3 min. Products were electrophoresed on a denaturing 20% polyacrylamide-7 M urea gel and exposed to BioMax MS film or analyzed with a Fuji FLA3000 Phosphor Imager. For translesion synthesis, the same amounts of templates containing specific lesions were used. For steady-state kinetics, 1 pmol of primer template (100 nM) was used, and the procedure was as previously described (13, 14). This procedure utilizes extensive titration of nucleotide concentration (1.0–1000 µM) and three appropriate time points (1–10 min), and produces results valid for a considerable range of enzyme concentration. The velocity (v) was determined by dividing the amount of reaction product by the reaction time. Vmax and Km were determined from a Hanes-Woolf plot of [dNTP]/v versus [dNTP]. The nucleotide misincorporation ratio, finc was determined by dividing (Vmax/Km)incorrect by (Vmax/Km)correct.


Figure 3
View larger version (68K):
[in this window]
[in a new window]
  		FIGURE 3.
Processivity of human POLN. A, enzyme titration. Decreasing amounts of POLN (91, 45, 23, 11.5, and 5.7 nM in lanes 2, 3, 4, 5, and 6, respectively) or Kf (exo-) (24, 12, 6, 3, and 1.5 nM in lanes 8, 9, 10, 11, and 12, respectively) were incubated in reaction mixtures with 500 fmol of M13mp18GTGx single-stranded template annealed to 5'-32P-labeled 24-mer primer for 10 min. Lanes 1 and 7 contained no enzyme. B, trap. 500 fmol of 5'-32P-labeled primer templates and POLN (23 nM in lanes 2–8) or Kf (exo-) (6 nM in lanes 9–15) with different amounts of poly(dA)/oligo(dT)10:1 as trapping reagent (0, 0.125, 0.25, 0.5, 1.0, and 2.0 pmol in lanes 2–8 and 9–15, respectively). Lane 1 contained no enzyme. In lanes 8 and 15, 2.0 pmol of trapping reagent were added first, before enzymes were added. C, time course. POLN (23 nM in lanes 2–8) or Kf (exo-) (6 nM in lanes 9–15) was incubated with 500 fmol of 5'-32P-labeled primer templates for the indicated time periods.

 
To optimize conditions and assay sensitivity to aphidicolin (Fisher), N-ethylmaleimide (NEM) (Sigma) or ddTTP (2',3'-dideoxythymidine-5'-triphosphate, Amersham Biosciences), a poly(dA)-oligo(dT)10:1 template was used instead of the 5'-labeled 16-mer primer annealed to the 30-mer template. Reaction mixtures (25 µl) contained 20 mM Tris-HCl pH 8.8 (unless otherwise indicated), 4% glycerol, 2 mM DTT, 80 µg/ml BSA, 8 mM Mg(C2H3O2)2 (unless otherwise indicated), 8 µg/ml of poly(dA)-oligo(dT)10:1, 10 µM dTTP, 1 µCi of [{alpha}-32P]dTTP, 23 nM POLN (unless otherwise indicated), and NaCl, aphidicolin, NEM or ddTTP as specified. After incubation at 37 °C for 20 min, reactions were stopped by adding 25 µl of 40 mM EDTA and placed on ice. A 10-µl aliquot of each mixture was spotted onto DE81 paper (Whatman), and washed three times with 0.5 M Na2HPO4 for 5 min and twice with ethanol. The paper was dried, and radioactivity was quantified with a Fuji Phosphor Imager. One unit of DNA polymerase activity was defined as the amount catalyzing the incorporation of 10 nmol of dTTP into poly(dA)/oligo(dT)10:1 template at 37 °C for 30 min.

Processivity Assay—Single-primed phagemid DNA templates were prepared by annealing the 5'-32P-labeled 24-mer primer to single-stranded M13mp18GTGx at a molar ratio of 2:1. POLN or Kf (exo-) was incubated with 500 fmol of the singly primed template at 37 °C in 10µl of polymerase buffer. For Kf (exo-) the buffer contained 50 mM Tris-HCl pH 7.2, 100 µM DTT, 10 mM MgSO4, and 100 µM each dNTP. Reactions were terminated by adding 10 µl of gel loading buffer and boiling at 95 °C for 3 min. Products were electrophoresed on a denaturing 10% polyacrylamide-7 M urea gel and exposed to BioMax MS film.

Translesion Synthesis Assays—The 5'-32P-labeled 16-mer primer annealed to the 30-mer template at a molar ratio of 1:1 was used as primer template. POLN, RB69 (gp43), POLB, pol I, Kf (exo-), POLH, or POLQ was incubated with 300 fmol of the primer template at 37 °C in 10 µl reactions. The buffer for POLN or Kf (exo-) was the same as given above. The buffer for RB69 (gp43) contained 10 mM Tris-HCl pH 7.9, 50 mM NaCl, 1 mM DTT, 200 µg/ml BSA, 10 mM MgCl2, and 100 µM each dNTP. The buffer for POLB contained 50 mM Tris-HCl pH 8.0, 50 mM NaCl, 1.5 mM DTT, 100 µg/ml BSA, 200 µM EDTA, 10 mM MgCl2, and 100 µM each dNTP. The buffer for E. coli pol I contained 50 mM Tris-HCl pH 7.2, 100 µM DTT, 10 mM MgSO4, and 100 µM each dNTP. The buffer for POLH contained 40 mM Tris-HCl pH 8.0, 2.5% glycerol, 45 mM KCl, 10 mM DTT, 250 µg/ml BSA, 5 mM MgCl2, and 100 µM each dNTP. The buffer for POLQ contained 20 mM Tris-HCl, pH 8.8, 4% glycerol, 80 µg/ml BSA, 100 µM EDTA, 8 mM MgCl2, and 100 µM each dNTP. Reactions were terminated by adding 10 µl of the gel loading buffer and boiling at 95 °C for 3 min. Products were electrophoresed on a denaturing 20% polyacrylamide-7 M urea gel and exposed to BioMax MS film.

Strand Displacement Assay—Substrates were prepared by mixing 5'-32P-labeled 16-mer primer, a downstream oligomer (5'-AAGATGCTGACGAG or 5'-AGATGCTGACGAG), and the 30-mer template at a molar ratio of 1:5:2 for use as a nicked substrate or 1-nt gap substrate, respectively. Reactions were performed under the same conditions as translesion synthesis assays. To measure the processivity of strand displacement, substrates were prepared by mixing the 5'-32P-labeled 24-mer primer, the downstream 60-mer oligomer with a 5'-phosphoryl or 5'-hydroxyl group (blocked at the 3'-end from priming using TdT and ddATP), and the single-stranded M13mp18GTGx at a molar ratio of 1:5:2.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Purification and Biochemical Properties of Human DNA Polymerase N—The human POLN cDNA was expressed in E. coli and tagged with six His residues at the N terminus and a FLAG epitope at the C terminus. Protein sequentially purified on FLAG antibody beads and TALON resin migrated near the expected Mr of 102,000 (Fig. 1, A and B). POLN could extend DNA on a primed template whereas the active site mutant (D623A) showed no DNA polymerase activity (Fig. 1C). This residue is highly conserved in motif 3 of A-family DNA polymerases and is important in coordinating bivalent metal ions to interact with an incoming nucleotide (15). The DNA binding activity of POLN was not influenced by this substitution (data not shown). POLN lacks sequences corresponding to a 3'-5' exonuclease domain, and no exonuclease activity was detected when enzyme and substrate were incubated without dNTPs (Fig. 1D). POLN showed limited TdT activity and was able to add one nucleotide, particularly dAMP, to the 3'-end of a double-stranded template, but not on a single-stranded template (Fig. 1E). Non-templated addition at a blunt end is a common feature of A-family DNA polymerases (16, 17).


Figure 4
View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 4.
Nucleotide selectivities of POLN. 23 nM POLN was incubated with 300 fmol of 5'-32P-labeled 16-mer primer annealed to a 30-mer DNA in the presence of one of the indicated dNTPs (100µM) for 10 min. The first template base denoted by X was changed from A (lanes 1–4) to C (lanes 5–8), G (lanes 9–12), and T (lanes 13–16). Template bases are indicated on the left.

 
The optimal reaction conditions for human POLN were determined using a poly(dA)/oligo(dT)10:1 substrate. The optimal pH was 8.8, the same as POLQ (5) (data not shown). Like POLQ (4), the DNA polymerase activity of POLN was highest in reaction mixtures that contained no salt, and increasing concentrations of NaCl inhibited the activity with 50% inhibition at 200 mM. POLN required a bivalent cation, and the optimal concentration was 8 mM Mg2+. Mn2+ at 4 mM provided 29% of the optimal activity. There was no difference between Mg(C2H3O2)2 and MgCl2 (not shown). Aphidicolin, which is an inhibitor of B-family DNA polymerases such as T4 DNA polymerase, had no inhibitory effect on POLN or Kf (exo-), respectively (Fig. 2A). Like Kf (exo-), POLN was relatively insensitive to NEM, whereas T4 DNA polymerase was sensitive (Fig. 2B). The specific activity of POLN with these optimal conditions was 125 units/mg.

A single aromatic residue in motif 4 of A-family DNA polymerases, either Phe or Tyr, is highly conserved and critical for ddNTPs selectivity (Fig. 2D). Replacing Tyr526 of T7 DNA polymerase with Phe increases discrimination against ddNTPs, whereas replacing Phe667 of Taq pol I or Phe762 of E. coli pol I with Tyr decreases discrimination against ddNTPs (18). POLN has a Tyr682 at the homologous position, and the DNA polymerase activity of POLN was inhibited by ddTTP on the poly(dA)-oligo(dT) template (Fig. 2C). Human POLQ with Tyr2389 (4) or Drosophila Mus308 with Tyr1882 (19) is also inhibited by ddNTP.

Processivity of Human DNA Polymerase N—To examine the processivity of POLN, a 5'-labeled 24-mer oligonucleotide was annealed to single-stranded circular M13 phage DNA and extension analyzed. The assay was performed in several ways to favor products resulting from a single binding event of POLN to the primer template. In an enzyme titration, POLN could elongate DNA chains as much as ~100–150 nt (Fig. 3A). The product distribution was retained in the presence of an excess amount of poly(dA)/oligo(dT)10:1 as a trapping agent (Fig. 3B), and products of >100 nt were observed after only 5 min (Fig. 3C). The pattern was similar to that produced by Kf (exo-) (Fig. 5, A–C), which also gives products of 1–100 nt (20). Thus, the processsivity of human POLN is considerably greater than the processivity of 1–10 nt typically observed for X and Y family DNA polymerases.


Figure 5
Figure 5
View larger version (154K):
[in this window]
[in a new window]
  		FIGURE 5.
Translesion synthesis by human POLN. Increasing amounts of RB69 (gp43) (2.4, 4.8, and 9.5 pM in lanes 2–4), POLB (75, 150, and 300 pM in lanes 6–8), pol I (2.3, 4.6, and 9.2 pM in lanes 10–12), Kf (exo-) (0.23, 0.46, and 0.92 pM in lanes 14–16), POLH (0.27, 0.54, and 1.08 nM in lanes 18–20), POLQ (2.8, 5.7, and 11.3 nM in lanes 22–24) or POLN (5.7, 11.3, and 23 nM in lanes 26–28) were incubated with the 5'-32P-labeled primer templates indicated beside each panel at 37 °C for 10 min. Lanes 1, 5, 9, 13, 17, 21, and 25 contained no enzyme. A, undamaged control; B, 1,2-d(GpG) cisplatin adduct; C, AP analog; D, 5S-Tg; E, 5R-Tg; F, T-T CPD; G, T-T 6–4 PP. In part A the percent (%) extension of the primer is shown below each lane.

 
Unusual Fidelity Properties of POLN—Prokaryotic A-family DNA polymerases have relatively high fidelities and contribute to error-free DNA synthesis. The human A-family DNA polymerase POLQ has low fidelity, however (5). We analyzed the fidelity of POLN using a 30-mer template with a 16-mer primer (Fig. 4). When the first template base was G, POLN frequently incorporated the incorrect nucleotide T when dTTP was the only deoxynucleotide present, (Fig. 4, lane 4). Incorporation of G across from template G and further extension past a noncomplementary G-T base pair was also observed (Fig. 4, lane 3). With template T, POLN usually incorporated A but also frequently incorporated the incorrect base G (Fig. 4, lane 7). When the first template base was A, POLN usually incorporated the correct base T but also incorporated an extra incorrect T opposite the following template T (Fig. 4, lane 12). With template C, POLN frequently incorporated the correct choice G opposite the first template C, and extended further by incorporating G opposite the following template T (Fig. 4, lane 15). These experiments indicated that POLN catalyzes considerable misincorporation, particularly by incorporating T opposite G and G opposite T.

To examine the fidelity of POLN, kinetic parameters were determined. We examined the template (first template base G) on which POLN appeared to incorporate incorrect bases most frequently (Fig. 4). Measurements were obtained with other incoming nucleotides, and from the ratio Vmax/Km (13), a misincorporation frequency (finc) was calculated. Compared with a value of 1.0 for correct utilization of dCTP opposite template G, these were 8.2 x 10–3 for dATP, 3.6 x 10–2 for dGTP and 4.5 x 10–1 for dTTP (Table 1). These values are about 100 times higher than the misincorporation frequency of ~10–5 to 10–4 found for Kf (exo-) or Taq pol I (21–23) and are closer to the values found for Y-family DNA polymerases (24). The finc value for misincorporation of T opposite template G was especially remarkable.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Fidelity of POLN on normal DNA and at a Tg

 
To further compare the fidelity with that of other DNA polymerases, we examined incorporation with first template base T. For POLH and Kf (exo-), the Km and Vmax values for incorporation of A opposite template T were similar to values previously reported (5, 14, 25) and were similar, within a few fold, to the corresponding values for human POLN (Table 1). Compared with a value of 1.0 for correct utilization of dATP opposite template T, the finc values were 2.1 x 10–4 for dCTP, 2.1 x 10–2 for dGTP and 3.2 x 10–3 for dTTP. Among these values, G misincorporation was highest and was similar to 2.0 x 10–2 found for POLQ or 7.9 x 10–2 for POLH (14). From these results, we conclude that human POLN is a low fidelity DNA polymerase.

POLN Efficiently Bypasses a Thymine Glycol in DNA and Shows Strand Displacement Activity—Some low fidelity DNA polymerases can perform translesion synthesis past certain types of DNA damage. To examine the activity of human POLN in this respect, a 5'-32P-labeled primer with a 3'-terminus located just before the lesion was annealed to templates containing either no damage, a 1,2 (dGpG) adduct produced by cis-diamminedichloroplatinum (II) (cisplatin), an abasic (AP) site, a 5S- or 5R-diastereoisomer of thymine glycol (Tg), a cyclobutane pyrimidine dimer (CPD), or a 6–4 photoproduct (6–4 PP). For comparison, the DNA polymerases RB69 (gp43), POLB, E. coli pol I (pol I), Kf (exo-), POLH, and POLQ were also tested on the same substrates. Quantities of DNA polymerases were chosen that gave rise to similar total amounts of products on undamaged substrate. All DNA polymerases except POLB could synthesize DNA products of up to 30 mer in length on the undamaged template (Fig. 5A). With a higher concentration (9.5 nM) of POLB, products up to 30 mer could be synthesized and most of the template was extended (not shown). RB69 (gp43), a highly processive enzyme, produced not only 30-mer products but also shorter products, because of its robust 3'-5' exonuclease activity (Fig. 5A, lanes 1–4).


Figure 6
View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 6.
Nucleotide preference for bypass of a 5S- or 5R-Tg. POLN (23 nM) was incubated with the 5'-32P-labeled 16-mer primer annealed to an undamaged 30-mer template (lanes 1–6), a template containing a 5S-Tg (lanes 7–12), or a template containing 5R-Tg (lanes 13–18) at 37 °C for 10 min. No dNTPs, all four dNTPs (N4), or each deoxynucleotide separately at 100 µM was utilized in reactions as indicated. The products were examined on the same gel.

 
POLN, POLQ (5), and most of the other DNA polymerases tested could not insert a nucleotide opposite the cisplatin adduct. POLH could incorporate one nucleotide opposite the first G of the adduct, and less frequently incorporated a base opposite the second G (26) (Fig. 5B, lanes 17–20). POLB could not extend primers from a cisplatin-GG adduct at the concentration used here, though it can bypass the adduct when a 105-106-fold higher concentration of POLB is used (27).

It is notable that POLN could not bypass an AP site, although the closely related POLQ can do so (Fig. 5C, lanes 21–28) (5). As reported previously (26), POLH was able to bypass an AP site, but synthesis usually stopped after incorporation of one nucleotide opposite the lesion (Fig. 5C, lanes 17–20). A smaller amount of stalled product at an AP-site obtained with POLQ in comparison to POLH is in good agreement with previous kinetic studies (5, 14). Pol I or Kf (exo-) incorporated one nucleotide opposite the AP-site (visible on a shorter exposure), and there was hardly any incorporation by POLN, RB69 (gp43), or POLB under these conditions.

On the 5S-Tg template, all DNA polymerases except RB69 (gp43) and POLB were able to bypass the lesion. However, reactions with POLN were particularly notable in that they gave a smaller amount of stalled product opposite the 5S-Tg by POLN than pol I, Kf (exo-), POLH, or POLQ (Fig. 5D, lanes 25–28). POLN could also bypass a 5R-Tg template lesion, but with more stalled product than with 5S-Tg (Fig. 5E, lanes 25–28). Conversely, POLH bypassed a 5R-Tg lesion more efficiently than a 5S-Tg lesion (14) (Fig. 5, D and E, lanes 17–20). POLQ bypassed both types of Tg lesions with similar efficiencies (5) (Fig. 5, D and E, lanes 21–24). Kf (exo-), pol I, or Kf (exo-) (28) were largely arrested after incorporating one nucleotide opposite either Tg lesion (Fig. 5, D and E, lanes 9–16). Pol I has 3'-5' exonuclease activity, and so stalled products were less abundant than with Kf (exo-) for 5S-Tg or 5R-Tg (Fig. 5, D and E, lanes 9–16). RB69 (gp43) and POLB showed very low bypass of 5S-Tg or 5R-Tg (Fig. 7, D and E, lanes 1–8).

POLN could not incorporate nucleotides opposite either a CPD or a 6–4 photoproduct (Fig. 5, F and G, lanes 25–28). Only POLH was able to bypass a CPD lesion efficiently (14), with some incorporation opposite the thymines in a 6–4 photoproduct (Fig. 5, F and G, lanes 17–20).

POLN Inserts an A Opposite a Thymine Glycol Lesion—As human POLN could bypass both thymine glycol isomers, particularly 5S-Tg, we examined the bypass reactions in more detail by analyzing their fidelity (Fig. 6). The results indicate a remarkable ability of POLN to bypass a 5S-Tg lesion. When the first template base was 5S-Tg, POLN efficiently incorporated the correct base A but not C, G, or T (Fig. 6, lanes 9–12). When the first template base was 5R-Tg, or an undamaged T, POLN usually incorporated the correct base A, but sometimes G (Fig. 6, lane 17). As determined by measuring kinetic parameters, the relative efficiency of incorporation of A opposite a 5S-Tg compared with a non-damaged template T was 16.7%; for a 5R-Tg, was 6.5% (Table 1). Incorporation of G opposite 5S-thymine glycol was considerably less efficient (Table 1). These results indicated that POLN can bypass 5S-Tg well and with a higher fidelity than on an undamaged T template. Thus, POLN efficiently carries out both the error-free insertion and extension steps for bypass of 5S-Tg.

Strand Displacement Activity of POLN—Pol I of E. coli has strand displacement and 5'-3' exonuclease activities that are used during DNA repair and Okazaki fragment maturation. The strand displacement activity of POLN was tested on substrates containing a nick or a 1-nt gap. Strand displacement synthesis is represented by products of >16 nt. POLN was very efficient at DNA synthesis on a nicked template and generated less stalled product than the other DNA polymerases tested (Fig. 7A). RB69 (gp43) could hardly synthesize DNA on this template (Fig. 7A, lanes 1–4). POLB had weak strand displacement activity as reported (29) (Fig. 7A, lanes 5–8). pol I and Kf (exo-) were able to catalyze strand displacement DNA synthesis; the products of pol I with 5'-3' exonuclease (nick translation) activity were more abundant than those produced by Kf (exo-) (Fig. 7A, lanes 9–16). As reported previously (30), POLH catalyzed strand displacement (Fig. 7A, lanes 17–20). POLN also could synthesize DNA efficiently on a template with a single nucleotide gap (Fig. 7B, lanes 21–24). POLB, which efficiently seals a single nt gap during short patch BER (31) produced more products than on the nicked template (Fig. 7B, lanes 5–8). These experiments indicate that POLN possesses considerable strand displacement activity.


Figure 7
View larger version (63K):
[in this window]
[in a new window]
  		FIGURE 7.
Strand displacement activity of human POLN. A and B, reactions with an array of DNA polymerases were performed as described in the legend to Fig. 5, incubating with the 5'-32P-labeled primer templates indicated beside each panel at 37 °C for 10 min with a nick-containing (A) or a gap-containing (B) substrate. Lanes 1, 5, 9, 13, 17, 21, and 25 contained no enzyme. C, processivity of strand displacement synthesis by POLN. Decreasing amounts of POLN (46, 23, 11.3, and 5.7 nM in lanes 1–4, 9–12, and 17–20, respectively) or Kf (exo-) (7.4 nM, 3.7 nM, 1.8 nM, and 0.92 pM in lanes 5–8, 13–16, 21–24, respectively) were incubated with 500 fmol of normal or nicked M13mp18GTGx substrate at 37 °C for 10 min. The substrates are schematically diagramed above the gels and were radiolabeled at the 5'-end of the upstream 24-mer primer (asterisk). The 5'-end of the downstream 60-mer oligonucleotides were hydrated or phosphorylated, and the 3'-end of the downstream oligonucleotides were blocked with ddTTP; phosphoryl-DNA (P) hydroxyl-DNA (OH). D, POLN (5.7 or 23 nM) was incubated with the undamaged substrate containing a 5'-32P-labeled primer (lanes 1 and 2) or a nicked substrate containing a 5'-32P-labeled primer (lanes 3 and 4) or a nicked substrate containing a 3'-32P-labeled oligomer (lanes 5 and 6).

 
To examine the processivity of the strand displacement activity, a 5'-labeled 24-mer primer was annealed to an M13mp18GTGx ssDNA template. Both POLN and Kf (exo-) synthesized products (Fig. 7C, lanes 1–8) similar to those shown in Fig. 3. When a downstream 60-mer oligonucleotide was annealed to generate a nick, Kf (exo-) was strongly inhibited by either 5'-phosphate or 5'-hydroxyl terminal duplex DNA (Fig. 7C, lanes 13–16 and 21–24). POLN could synthesize DNA by displacing the duplex DNA 10 bp or more (Fig. 7C, lanes 9–12 and 17–20). The use of a 60-mer downstream oligonucleotide (rather than the 14-mer used in Fig. 7A) revealed that POLN has a much stronger strand displacement activity than Kf (exo-). Although POLN does not have an intact 5' to 3' exonuclease motif, the possibility of 5'-3' exonuclease activity was checked by incubating POLN under the same conditions but with a 3'-labeled 14-mer downstream oligomer. POLN gave products for the nicked substrate as efficiently as for the substrate without downstream oligomer (Fig. 7D, lanes 1–4), but did not degrade the 14-mer downstream oligomer (Fig. 7D, lanes 5 and 6). These results indicate that human POLN catalyzes efficient strand displacement synthesis.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Understanding the individual functions of the many different DNA polymerases in vertebrate cells is a major challenge that increases in complexity with the discovery of each DNA polymerase. The present work characterizes the enzymatic activity of the most recently discovered of these DNA polymerases, DNA POLN. Our initial approach has been to gain information on what types of reactions POLN can perform, which may provide clues as to its likely function. The properties of POLN that distinguish it from other DNA polymerases in mammalian cells are its unusual fidelity properties, its ability to efficiently and accurate bypass thymine glycol, and its high capacity for strand displacement.

Unique Properties of POLN in Fidelity and Ability to Bypass Thymine Glycol—The most remarkable feature of DNA polymerase POLN with respect to fidelity is its ability to efficiently incorporate T opposite template G (~45% as well as C is incorporated opposite template G). This is a unique property not only among A-family DNA polymerases, but also among all other known DNA polymerases. The Y-family DNA polymerase POLI has the unique fidelity characteristic of efficiently catalyzing the inverse event, incorporation of G opposite template T (32). Most errors with POLI occur at template T as a result of G-T Hoogsteen base pairs rather than A-T Watson-Crick base pairs (33), and for POLI the Vmax/Km value of correct deoxynucleotide incorporation for template T is the lowest for all template bases (32). For POLN, we found no significant difference among the Vmax/Km values with different template bases (Table 1), and so misincorporation by POLN probably uses a mechanism different from POLI. POLN also is relatively efficient at incorporation of G opposite T. Although there might be biological scenarios where incorporation of T opposite G would be desirable, it seems more likely at present that the unusual misincorporation properties of POLN are related to its ability to bypass one or more specific forms of DNA damage.

In this respect, the preferential incorporation by POLN of A opposite Tg and its efficient extension from this lesion is notable. Tg lesions are a strong block to many DNA polymerases in vitro and in vivo (34). Neither isomer of thymine glycol can form a stable base pair with any nucleobase on the complementary strand (35), and DNA synthesis terminates after insertion of A opposite Tg. For example, in our experiments, DNA synthesis by the B-family DNA polymerase from RB69 (gp43) was blocked by either Tg isomer. In this respect, POLN is remarkable in that it is able to "correctly" incorporate an A opposite a Tg lesion, and then efficiently extend it. POLN misincorporates G opposite 5S-Tg (finc = 4.7 x 10–3) even more rarely than it misincorporates G across from an undamaged T (finc = 2.1 x 10–2) or 5R-Tg (finc = 5.3 x 10–2). Human POLH also can replicate through the 5R-Tg lesion efficiently, but the finc value for dGMP is 1.2 x 10–1 and is higher than the value for normal template T (finc = 7.9 x 10–2) (14). POLH is in this respect better adapted for error-free bypass of CPD (14).

Most repair of Tg in mammalian cells proceeds by BER, initiated by NEIL1 and NTH1 DNA glycosylases (36). HeLa cell extracts or mouse ES cell nuclear extracts remove 5R-Tg considerably faster than 5S-Tg, and so the latter lesion might be more frequently encountered by a DNA replication fork (36, 37). Use of POLN to bypass 5S-Tg with comparatively high efficiency and accuracy of bypass would be consistent with the low mutation frequency induced by Tg (38, 39).

POLN Has Remarkable Strand Displacement Activity—POLN can perform efficient strand displacement past a nick or a gap and gives rise to an amount of product similar to that on nondamaged template (Figs. 5A, 7A, and 7B). By contrast, strand displacement by POLB alone is weak (Fig. 7A), although protein factors such as FEN1, PARP1, the RAD9-RAD1-HUS1 complex, or WRN helicase can enhance strand displacement DNA synthesis of POLB (29, 40–42). Mouse cell extracts lacking POLB still have residual BER activity, even in the presence of aphidicolin, which inhibits DNA polymerase {delta} and {epsilon}, back-up DNA polymerases activity for BER (43). As POLN is aphidicolin-resistant and has strand displacement activity, it may be a good candidate for a further back-up activity in "long patch" BER. A role for POLN in error-prone BER at G-C base pairs in hypermutation of immunoglobulin variable genes (44) is also conceivable.

Mechanism of the Unique Properties of POLN—The distinguishing fidelity and bypass properties of POLN must be related to specific features of its protein sequence and structure. Although further experimentation and structural work will be necessary to gain further insight into this, we briefly point out several features here.

In the "fingers" subdomain of E. coli pol I and Taq pol I, the O-helix (motif 4), has numerous contacts with the incoming dNTP that contribute to proper positioning in the active site and to accuracy. Mutation of Thr664 to Arg in Taq pol I or mutation of the equivalent Ala759 residue to Arg in exonuclease-deficient E. coli pol I creates a highly error-prone DNA polymerase (45, 46). These changes may stabilize the enzyme in the closed conformation, favoring misincorporation (47). The corresponding residue in human POLN is Lys679, and it is Lys or Arg in POLN of other vertebrates (see Fig. 2D), so it is possible that this residue is a major determinant of fidelity. A further point of interest is that POLN has an insertion in the tip of the thumb subdomain, shorter than the 22-residue insert of POLQ (5), but in a region of the protein that is important for DNA binding (22, 48, 49).


   FOOTNOTES
 
* This work was supported by Grant CA101980 from the National Institutes of Health (to R. D. W.) and by the University of Pittsburgh Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed. Tel.: 412–623-7762; Fax: 412–623-2613; E-mail: rdwood{at}pitt.edu.

2 The abbreviations used are: POLN, human DNA polymerase N; pol, polymerase; BER, base excision repair; NER, nucleotide excision repair; Tg, thymine glycol; CPD, cyclobutane pyrimidine dimer; 6-4 PP, (6-4) photoproduct; NEM, N-ethylmaleimide; Kf (exo-), exonuclease-deficient Klenow fragment of E. coli DNA polymerase I; DTT, dithiothreitol; BSA, bovine serum albumin. Back


   ACKNOWLEDGMENTS
 
We thank Anthony Schuffert for assistance with the fidelity measurements. We are grateful to Dr. Mineaki Seki for providing POLQ protein, valuable advice, and discussions of DNA polymerases. We thank Dr. Birgitte Wittschieben, Dr. John Wittschieben, Dr. Beate Köberle, Gregory Gan, and members of Dr. V. Rapic-Otrin's laboratory for advice on experiments and comments on the manuscript. Donations of reagents by Drs. R. Sobol, C. Masutani, F. Hanaoka, and W. Konigsberg are much appreciated.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hübscher, U., Maga, G., and Spadari, S. (2002) Annu. Rev. Biochem. 71, 133–163[CrossRef][Medline] [Order article via Infotrieve]
  2. Marini, F., Kim, N., Schuffert, A., and Wood, R. D. (2003) J. Biol. Chem. 278, 32014–32019[Abstract/Free Full Text]
  3. Pang, M., McConnell, M., and Fisher, P. A. (2005) DNA Repair (Amst) 4, 971–982[Medline] [Order article via Infotrieve]
  4. Seki, M., Marini, F., and Wood, R. D. (2003) Nucleic Acids Res. 31, 6117–6126[Abstract/Free Full Text]
  5. Seki, M., Masutani, C., Yang, L. W., Schuffert, A., Iwai, S., Bahar, I., and Wood, R. D. (2004) EMBO J. 23, 4484–4494[CrossRef][Medline] [Order article via Infotrieve]
  6. Schleiermacher, G., Bourdeaut, F., Combaret, V., Picrron, G., Raynal, V., Aurias, A., Ribeiro, A., Janoueix-Lerosey, I., and Delattre, O. (2005) Oncogene 24, 3377–3384[CrossRef][Medline] [Order article via Infotrieve]
  7. Yang, G., Franklin, M., Li, J., Lin, T. C., and Konigsberg, W. (2002) Biochemistry 41, 10256–10261[CrossRef][Medline] [Order article via Infotrieve]
  8. Murata, T., Iwai, S., and Ohtsuka, E. (1990) Nucleic Acids Res. 18, 7279–7286[Abstract/Free Full Text]
  9. Iwai, S., Shimizu, M., Kamiya, H., and Ohtsuka, E. (1996) J. Am. Chem. Soc. 118, 7642–7643
  10. Shimizu, T., Manabe, K., Yoshikawa, S., Kawasaki, Y., and Iwai, S. (2006) Nucleic Acids Res. 34, 313–321[Abstract/Free Full Text]
  11. Szymkowski, D. E., Yarema, K. J., Essigmann, J. E., Lippard, S. J., and Wood, R. D. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10772–10776[Abstract/Free Full Text]
  12. Moggs, J. G., Yarema, K. J., Essigmann, J. M., and Wood, R. D. (1996) J. Biol. Chem. 271, 7177–7186[Abstract/Free Full Text]
  13. Creighton, S., Bloom, L. B., and Goodman, M. F. (1995) Methods Enzymol. 262, 232–256[Medline] [Order article via Infotrieve]
  14. Kusumoto, R., Masutani, C., Iwai, S., and Hanaoka, F. (2002) Biochemistry 41, 6090–6099[CrossRef][Medline] [Order article via Infotrieve]
  15. Li, Y., Korolev, S., and Waksman, G. (1998) EMBO J. 17, 7514–7525[CrossRef][Medline] [Order article via Infotrieve]
  16. Clark, J. M., Joyce, C. M., and Beardsley, G. P. (1987) J. Mol. Biol. 198, 123–128[CrossRef][Medline] [Order article via Infotrieve]
  17. Clark, J. M. (1988) Nucleic Acids Res. 16, 9677–9686[Abstract/Free Full Text]
  18. Tabor, S., and Richardson, C. C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 6339–6343[Abstract/Free Full Text]
  19. Harris, P. V., Mazina, O. M., Leonhardt, E. A., Case, R. B., Boyd, J. B., and Burtis, K. C. (1996) Mol. Cell. Biol. 16, 5764–5771[Abstract]
  20. Eckert, K. A., and Kunkel, T. A. (1993) J. Biol. Chem. 268, 13462–13471[Abstract/Free Full Text]
  21. Bebenek, K., Joyce, C. M., Fitzgerald, M. P., and Kunkel, T. A. (1990) J. Biol. Chem. 265, 13878–13887[Abstract/Free Full Text]
  22. Minnick, D. T., Bebenek, K., Osheroff, W. P., Turner, R. M., Jr., Astatke, M., Liu, L., Kunkel, T. A., and Joyce, C. M. (1999) J. Biol. Chem. 274, 3067–3075[Abstract/Free Full Text]
  23. Suzuki, M., Yoshida, S., Adman, E. T., Blank, A., and Loeb, L. A. (2000) J. Biol. Chem. 275, 32728–32735[Abstract/Free Full Text]
  24. Goodman, M. F. (2002) Annu. Rev. Biochem. 71, 17–50[CrossRef][Medline] [Order article via Infotrieve]
  25. Polesky, A. H., Steitz, T. A., Grindley, N. D., and Joyce, C. M. (1990) J. Biol. Chem. 265, 14579–14591[Abstract/Free Full Text]
  26. Masutani, C., Kusumoto, R., Iwai, S., and Hanaoka, F. (2000) EMBO J. 19, 3100–3109[CrossRef][Medline] [Order article via Infotrieve]
  27. Vaisman, A., and Chaney, S. G. (2000) J. Biol. Chem. 275, 13017–13025[Abstract/Free Full Text]
  28. Purmal, A. A., Lampman, G. W., Bond, J. P., Hatahet, Z., and Wallace, S. S. (1998) J. Biol. Chem. 273, 10026–10035[Abstract/Free Full Text]
  29. Prasad, R., Lavrik, O. I., Kim, S. J., Kedar, P., Yang, X. P., Vande Berg, B. J., and Wilson, S. H. (2001) J. Biol. Chem. 276, 32411–32414[Abstract/Free Full Text]
  30. McDonald, J. P., Frank, E. G., Plosky, B. S., Rogozin, I. B., Masutani, C., Hanaoka, F., Woodgate, R., and Gearhart, P. J. (2003) J. Exp. Med. 198, 635–643[Abstract/Free Full Text]
  31. Klungland, A., and Lindahl, T. (1997) EMBO J. 16, 3341–3348[CrossRef][Medline] [Order article via Infotrieve]
  32. Tissier, A., McDonald, J. P., Frank, E. G., and Woodgate, R. (2000) Genes Dev. 14, 1642–1650[Abstract/Free Full Text]
  33. Johnson, R. E., Washington, M. T., Haracska, L., Prakash, S., and Prakash, L. (2000) Nature 406, 1015–1019[CrossRef][Medline] [Order article via Infotrieve]
  34. Wallace, S. S. (2002) Free Radic Biol. Med. 33, 1–14[CrossRef][Medline] [Order article via Infotrieve]
  35. Iwai, S. (2001) Chemistry 7, 4343–4351[CrossRef][Medline] [Order article via Infotrieve]
  36. Katafuchi, A., Nakano, T., Masaoka, A., Terato, H., Iwai, S., Hanaoka, F., and Ide, H. (2004) J. Biol. Chem. 279, 14464–14471[Abstract/Free Full Text]
  37. McTigue, M. M., Rieger, R. A., Rosenquist, T. A., Iden, C. R., and De Los Santos, C. R. (2004) DNA Repair (Amst) 3, 313–322[Medline] [Order article via Infotrieve]
  38. Basu, A. K., Loechler, E. L., Leadon, S. A., and Essigmann, J. M. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 7677–7681[Abstract/Free Full Text]
  39. Hayes, R. C., Petrullo, L. A., Huang, H. M., Wallace, S. S., and LeClerc, J. E. (1988) J. Mol. Biol. 201, 239–246[CrossRef][Medline] [Order article via Infotrieve]
  40. Ahn, B., Harrigan, J. A., Indig, F. E., Wilson, D. M., 3rd, and Bohr, V. A. (2004) J. Biol. Chem. 279, 53465–53474[Abstract/Free Full Text]
  41. Harrigan, J. A., Opresko, P. L., von Kobbe, C., Kedar, P. S., Prasad, R., Wilson, S. H., and Bohr, V. A. (2003) J. Biol. Chem. 278, 22686–22695[Abstract/Free Full Text]
  42. Toueille, M., El-Andaloussi, N., Frouin, I., Freire, R., Funk, D., Shevelev, I., Friedrich-Heineken, E., Villani, G., Hottiger, M. O., and Hübscher, U. (2004) Nucleic Acids Res. 32, 3316–3324[Abstract/Free Full Text]
  43. Parlanti, E., Pascucci, B., Terrados, G., Blanco, L., and Dogliotti, E. (2004) DNA Repair (Amst) 3, 703–710[Medline] [Order article via Infotrieve]
  44. Seki, M., Gearhart, P. J., and Wood, R. D. (2005) EMBO Reports 6, 1143–1148[CrossRef][Medline] [Order article via Infotrieve]
  45. Camps, M., Naukkarinen, J., Johnson, B. P., and Loeb, L. A. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 9727–9732[Abstract/Free Full Text]
  46. Suzuki, M., Avicola, A. K., Hood, L., and Loeb, L. A. (1997) J. Biol. Chem. 272, 11228–11235[Abstract/Free Full Text]
  47. Patel, P. H., Suzuki, M., Adman, E., Shinkai, A., and Loeb, L. A. (2001) J. Mol. Biol. 308, 823–837