HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 42, 31380-31388, October 20, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/42/31380    most recent M606603200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liu, X. Articles by Luo, Y. Search for Related Content PubMed PubMed Citation Articles by Liu, X. Articles by Luo, Y. Social Bookmarking                      What's this?

Quantitative Analysis of Anti-apoptotic Function of Akt in Akt1 and Akt2 Double Knock-out Mouse Embryonic Fibroblast Cells under Normal and Stressed Conditions^*

Xuesong Liu¹, Yan Shi, Morris J. Birnbaum, Keqiang Ye^¶, Ron De Jong^||, Tillman Oltersdorf^||, Vincent L. Giranda, and Yan Luo²

From the Department of Cancer Research (R47S), Abbott L, Abbott Park, Illinois 60064, the Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, the ^¶Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia 30322, and ^||Idun Pharmaceuticals, San Diego, California 92121

Received for publication, July 11, 2006 , and in revised form, August 14, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The serine/threonine kinases Akt1/PKB, Akt2/PKB, and Akt3/PKB have been implicated in preventing cells from undergoing apoptosis. Although several small molecule inhibitors of Akt have been reported to induce apoptosis in cancer cells, these inhibitors may have additional targets. In the current study, we used an Akt3 small interfering RNA (Akt3 siRNA) to analyze apoptosis induction in Akt1 and Akt2 double knock-out mouse embryonic fibroblast cells (MEF-Akt1,2-DKO). Our data indicated that Akt3 siRNA inhibited Akt3 protein expression in a dose-dependent manner. As a result, phosphorylation of Akt and its downstream targets, including FKHRL1 and GSK3/, were reduced accordingly. The treatment also induced apoptosis in MEF-Akt1,2-DKO cells. However, apoptosis induction is significant only when more than 80% of Akt3 protein was depleted. Reintroducing Akt3 totally rescued Akt3-siRNA-induced apoptosis in MEF-Akt1,2-DKO cells. In addition, reintroducing Akt1 also inhibited apoptosis induced by Akt3 siRNA. Moreover, Akt3 siRNA potentiated different stress-induced apoptosis in MEF-Akt1,2-DKO cells at a lower dose when compared with what is required for apoptosis induction by itself. Our study suggests that only a small portion of Akt is active in wild-type MEF cells and a threshold of Akt inhibition is required to induce apoptosis by pure Akt inhibitors. In addition, our data indicate that cells under stress require more Akt for its survival.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The Akt/PKB³ protein, referred to hereafter as Akt, plays a critical role in preventing cells from undergoing apoptosis (1). Akt is a serine/threonine protein kinase originally identified as a cellular homolog of the viral oncogene Akt8 (2). The three isoforms of Akt (Akt1/PKB, Akt2/PKB, Akt3/PKB) share a high degree of structural similarity and sequence homology (3–8). It also appears that each isoform may play unique as well as common roles in cells (9–12); Akt1 knock-out mice are growth-retarded (9), Akt2 knock-out mice develop diabetes-like symptoms because of the impaired insulin response (10, 12), and Akt3 knock-out mice show reduced brain size (11).

The current model (13–16) suggests that Akt is activated through the phosphatidylinositol 3-kinase pathway upon growth factor stimulation. The products of phosphatidylinositol 3-kinase, especially phosphatidylinositol 3,4,5-triphosphate, can bind to the PH domain of Akt (13–15). The binding of phosphatidylinositol 3,4,5-triphosphate to the PH domain of Akt targets the protein to the plasma membrane, where it can be phosphorylated on two key residues: Thr-308 (phosphorylated in the activation loop by PDK1 (16)) and Ser-473 (phosphorylated in the hydrophobic motif of the C-terminal tail by PDK2, for which identity is still not well defined). Several candidates for PDK2 have been proposed, including PDK1 (17), Integrin-linked kinase (18), Akt itself (19), DNA-PKcs (20), and recently the mTOR-Rictor complex (21). Phosphorylation of both Thr-308 and Ser-473 is required for full activation of Akt.

A number of substrates for Akt have been identified, including the pro-apoptotic protein Bad, caspase-9, forkhead transcription factor (FKHRL1), IB kinase kinase, glycogen synthase kinase 3 / (GSK3/), MDM2, p21cip1/WAF1, TSC2, etc (1, 22). Among these, Bad, caspase-9, and the Forkhead transcription factors are pro-apoptotic proteins, and their phosphorylation by Akt abolishes their pro-apoptotic activities (1, 22).

Although Akt proteins play critical roles in preventing cells from undergoing apoptosis, there is evidence that the anti-apoptotic function of different Akt isoforms maybe redundant. Down-regulation of Akt1 or Akt2 by small interfering RNA (siRNA) in HeLa cells had no effect on cell growth on extracellular matrix (23). Moreover, Akt1 and Akt2 are dispensable for cell survival in isolated osteoclast precursors (24), possibly because of the redundant function from Akt3. Although several Akt inhibitors have been reported to induce apoptosis in cancer cells, these inhibitors may have additional targets other than Akt (25–27). In the current study, we used an Akt3 siRNA to analyze apoptosis induction in Akt1 and Akt2 double knockout MEF cells (MEF-Akt1,2-DKO). Our data indicate that Akt3 siRNA inhibits Akt3 protein expression and the phosphorylation of Akt downstream targets including FKHRL1 and GSK3/.Asa result, apoptosis is induced in MEF-Akt1,2-DKO cells. Apoptosis is obvious when more than 80% Akt3 down-regulation is achieved by Akt3 siRNA. Reintroduction of Akt3 or Akt1 prevents apoptosis induced by Akt3 siRNA. In addition, Akt3 siRNA potentiates different forms of stress-induced apoptosis in MEF-Akt1,2-DKO cells at a lower dose compared with what is required for apoptosis induction by itself. Our study provides evidence that a threshold of Akt inhibition is required to induce apoptosis and that cells under stress require more Akt for survival.

View larger version (40K): [in this window] [in a new window]   FIGURE 1. Akt protein levels in MEF cells. The indicated cells were cultured, and cell extracts were prepared as described under"Materials and Methods." A, 50 µg of cell extracts prepared from different cell lines were loaded onto 10% SDS-polyacrylamide gels and subjected to Western blot analysis using Akt, Akt3, phospho-Akt, and actin antibodies as described under"Materials and Methods."Data are representative of four independent experiments. B–D, Akt, Akt3, and phospho-Akt levels in different cell lines. The density of the protein bands was quantitated using ImageQuant software with the Storm system (Molecular Devices). Total Akt (B), Akt3 (C), and phospho-Akt (D) protein levels were normalized to actin. Shown is the mean ± S.D. from four independent experiments. E, 12.5, 25, and 50 µg of cell extracts prepared from different cell lines were loaded onto 10% SDS-polyacrylamide gels and subjected to Western blot analysis using phospho-Akt, and actin antibodies as described under"Materials and Methods."Shown is a representative from three independent experiments.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cell Lines—MEF cells were generated as described previously from mouse embryo at embryonic day 13.5 (29). The mouse embryos with the head and internal organs discarded were chopped and minced in the presence of trypsin (Invitrogen, cell culture grade). Isolated cells were washed twice with serum-free DMEM and subcultured in 10% fetal bovine serum-DMEM. For immortalization, 3 million cells were trypsinized and replated in 10-cm culture dish every 3 day. The wild-type and Akt2 knock-out MEF cells were obtained after 20 passages. The Akt1 knock-out and Akt1/2 double knock-out MEF cells were obtained after 30 passages.

SiRNA Transfection—Annealed, purified, and desalted double-stranded Akt3 siRNA-1 (Akt3-si-1, AAGGAUGAAGUGGCACACACU), Akt3 siRNA2 (Akt3-si-2, AAGAGGGUUGGGUUCAGAAGA), and control siRNA(Akt3-si-c,AAGGAUGAGUGAGCACACACU) were synthesized by Dharmacon (Lafayette, CO). For transfection, 0.6 x 10⁶ MEF-Akt1,2-DKO cells were plated in a 10-cm dish on day 0. On day 1, 30 µl of Lipofectamine 2000 reagent (LF2000, Invitrogen) was added to 2 ml of Opti-MEM (Invitrogen) and incubated at room temperature for 5 min (solution A). Then Akt3 siRNA was added to 2 ml of Opti-MEM (solution B). Solution A and solution B were mixed and incubated at room temperature for 20 min. The medium in the plate was removed, and the LF2000-siRNA mixture was laid onto the cells. Four hours after incubation at 37 °C in a CO₂ incubator, the LF2000-siRNA mixture was replaced with medium containing DMEM and fetal bovine serum. The cells were harvested 72 h post-transfection for Western blot analysis and cytochemical staining analysis for apoptosis.

Western Blot Analysis—The Akt3 antibody was described previously (11). Rabbit anti-Akt, anti-phospho-Akt (Ser-473), antiphospho-FKHRL1 (Thr-32), anti-phospho-GSK3/ (Ser-21/9), and anti-phospho-p70S6K (Thr-389) antibodies were from Cell Signaling (Beverly, MA). Anti-actin and anti-GSK3/ antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Immunoblot analysis was performed with horseradish peroxidase-conjugated goat anti-rabbit IgG (Amersham Biosciences) using an ECL Western blotting detection reagent (Amersham Biosciences) as described previously (30).

Preparation of Cell Extracts—Cells from 10 cm Petri dishes were harvested and lysed in 200 µl of buffer B (20 mM Hepes, pH 7.5, 10 mM NaCl, 20 mM NaF, 1 mM EDTA, 1 mM EGTA, 5 mM sodium pyrophosphate, 2 mM sodium vanadate, 10 mM -glycerophosphate, and 1% Nonidet P-40) on ice for 30 min. The samples were centrifuged at 12,000 x g at 4 °C for 10 min, and the supernatants were used as cell extracts.

View larger version (62K): [in this window] [in a new window]   FIGURE 2. Akt3 siRNAs reduce Akt3 protein levels and induce apoptosis in MEF-Akt1,2-DKO cells. A, MEF-Akt1,2-DKO cells were transfected with the indicated concentrations of Akt3 siRNAs (Akt3-si-1 and Akt3-si-2) or control siRNA (Akt3-si-c). Seventy-two hours after transfection, cells were harvested, and extracts were prepared. 50 µg of each extract was subjected to Western blot analysis using antibodies against Akt3, phospho-Akt, phospho-GSK3/, phospho-FKHRL1, GSK3/, or phospho-p70S6K. Shown is a representative from three independent experiments. B, the density of the protein bands was quantitated using ImageQuant software with the Storm system (Molecular Devices). The Akt3 protein levels were normalized to GSK3. Shown is the mean ± S.D. from three independent experiments. C, DAPI staining analysis of apoptotic cells in MEF-Akt1,2-DKO cells transfected with Akt3 siRNA. Shown is the mean ± S.D. from three independent experiments. D, MEF-Akt1,2-DKO cells transfected with the indicated concentration of Akt3 siRNA were stained with PE-conjugated anti-active caspase-3 as described under "Materials and Methods." E, MEF-Akt1,2-DKO cells were transfected with 10 nM Akt3-si-1 and control RNA in the presence or absence of 100 µM Z-VAD. Cells were stained with PE-conjugated anti-active caspase-3 as described under "Materials and Methods."

Plasmid Construction—Human Akt3 cDNA was generated by PCR using genomic DNA prepared from normal human fibroblast. The Akt3 cDNA was used as template, and the following primers were used to generate the N- and C-terminal halves of Akt3 by PCR: primer pair 1, 5'-AGTCGCGGCCGCATGAGCGATGTTACC-3'(Akt3-NotI-F)/5'-TAGTGTCTGAGCGAGATCTTCGTTTGCAATAATGACTTC-3' (Akt3-M-R); pair 2, 5'-GCAAACGAAGATGTCGCTCAGACACTAACTGAAAGCAGAG-3' (Akt3-M-F)/5'-AGTCGATATCTTATTCTCGTCCACTTG-3' (Akt3-EcoRV-R). To generate an Akt3 mutant in which mRNA could not be recognized by Akt-3-si-1, the above PCR products were purified, mixed, and used as template for PCR using primers Akt3-NotI-F/Akt3-EcoR-V-R. The PCR product was purified and cloned into pAd-Track-CMV to obtain pAdTrack-CMV-Akt3M. The mutated Akt3 was confirmed by DNA sequencing.

Cytochemical Staining of Apoptotic Cells—Cells undergoing apoptosis were detected by staining with 4,6-diamidino-2-phenylindole (DAPI) as described previously with minor modifications (31). In brief, cells were fixed with 2% paraformaldehyde, 0.2% Triton X-100 in phosphate-buffered saline, incubated at room temperature for 10 min, centrifuged at 1000 x g for 10 min, and resuspended in 20 µl of 0.1% DAPI in phosphatebuffered saline. After a 15-min incubation at room temperature, 10 µl of resuspended cells were placed on a glass slide, and 600 cells/slide were scored for the incidence of apoptotic chromatin changes using a fluorescence microscope.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Akt3 siRNA Reduces Akt3 Protein Levels in MEF-Akt1,2-DKO Cells—We examined the expression levels and activation status of total Akt and Akt3 in four MEF cell lines: wild-type MEF (MEF-WT), Akt1 knock-out MEF (MEF-Akt1-KO), Akt2 knock-out MEF (MEF-Akt2-KO), and Akt1 and Akt2 double knock-out MEF cells (MEF-Akt1,2-DKO). Western blot analysis showed that total Akt levels were reduced in Akt knock-out MEF cells, with the most reduction in MEF-Akt1,2-DKO cells (Fig. 1, A and B). The Akt3 protein levels stayed the same in all four cell lines (Fig. 1, A and C). A phospho-Ser-473-specific antibody for all Akt proteins was used to detect active Akt proteins. Surprisingly, the total phospho-Akt levels also stayed the same in all four MEF cells (Fig. 1, A, D, and E), suggesting that only a small amount of active Akt is required to maintain normal cell functions.

To study the effect of inhibiting Akt3 in MEF-Akt1,2-DKO cells, we designed two Akt3 siRNAs (Akt3-si-1, Akt3-si-2) and a control siRNA (Akt3-si-c) by flipping the four nucleotide sequence in the middle of Akt3-si-1. Akt3-si-1 reduced Akt3 protein levels more potently than Akt3-si-2. As shown in Fig. 2, A and B, Akt3 protein levels were reduced in a dose-dependent manner with a reduction of 0, 28, 51, 82, and 91% at 0.001, 0.01, 0.1, 1, and 10 nM Akt3-si-1, respectively. The other Akt3 siRNA, Akt3-si-2, reduced Akt3 protein by 63% at 10 nM (Fig. 2, A and B). A nonspecific protein (X) that cross-reacted with the Akt3 antibody was shown (Fig. 2A).

Inhibition of Akt3 expression also reduced the phosphorylation of Akt and Akt downstream targets including GSK3/ and FKHRL1. Significant reductions in phospho-Akt and phospho-FKHRL1 were observed in MEF-Akt1,2-DKO cells transfected with either Akt3-si-1 at 1 nM or 10 nM or Akt3-si-2 at 10 nM (Fig. 2A). The extent of inhibition of phosphorylation of Akt3 and FKHRL1 correlates well with the extent of Akt3 protein knockdown (Fig. 2A). Although partial inhibition of phospho-GSK3/ and p70S6K Thr-389 phosphorylation was achieved by Akt3-si-1 at 10 nM, the effect of Akt3-si-2 on the phosphorylation of GSK3/ and p70S6K was not obvious, even though Akt3-si-2 inhibited 63% of Akt3 expression (Fig. 2A).

The Akt3 siRNA-treated MEF-Akt1,2-DKO cells were subjected to an apoptosis assay. Low concentrations of Akt3-si-1, up to 0.1 nM, did not induce significant apoptosis even though Akt3 protein levels were reduced 51% (Fig. 2, A–C). Significant apoptosis was observed in MEF-Akt1,2-DKO cells transfected with Akt3-si-1 at 1 and 10 nM, with 19.5 and 35% apoptosis induction, respectively (Fig. 2C). Akt3-si-2, which inhibited 63% of Akt3 expression at 10 nM, induced 8% apoptosis (Fig. 2C). The control siRNA, Akt3-si-c, had 4% apoptosis induction at 10 nM (Fig. 2C). Similar results for apoptosis induction were observed in MEF-Akt1,2-DKO cells transfected with Akt3-si-1 and Akt3-si-c when these cells were stained for active caspase-3 with PE-conjugated anti-active caspase-3 antibody (Fig. 2D). In addition, the nonspecific caspase inhibitor Z-VAD-fmk completely prevented Akt3-si-1-induced apoptosis in MEF-Akt1,2-DKO cells (Fig. 2E).

View larger version (29K): [in this window] [in a new window]   FIGURE 3. Overexpression of Akt3 rescues Akt3-siRNA-induced apoptosis in MEF-Akt1,2-DKO cells. MEF-Akt1,2-DKO cells were transfected with LF2000, 10 nM Akt3-si-1, or 10 nM Akt3-si-c in the presence of 3 µg of pAdTrack-CMV (Vector) or pAdTrack-CMV-Akt3M (Akt3). After 72 h, cells were harvested, and extracts were prepared. A, DAPI staining analysis of apoptotic cells in green fluorescent protein-positive MEF-Akt1,2-DKO cells. Shown is the mean ± S.D. from three independent experiments. B,50 µg of the extract was subjected to Western blot analysis using antibodies against Akt3 and actin. Shown is a representative from three independent experiments.

View larger version (21K): [in this window] [in a new window]   FIGURE 4. Overexpression of Akt1 inhibits Akt3-siRNA-induced apoptosis in MEF-Akt1,2-DKO cells. A and B, MEF-Akt1,2-DKO cells were plated in the absence or presence of Akt1 adenovirus (multiplicity of infection = 1). The cells were then transfected with 1 nM Akt3 siRNA as described under "Materials and Methods." Cells were harvested and subjected to Western blot analysis of Akt3, Phospho-Akt, phospho-FKHRL1, phospho-GSK3/, Akt, and actin (A), and apoptotic cells were subjected to DAPI staining analysis (B). C and D, MEF-Akt2-KO cells were transfected with LF2000, 10 nM Akt3-si-1, and 10 nM control RNA as described under "Materials and Methods." Cells were subjected to Western blot analysis of Akt3, phospho-Akt, Akt, phospho-FKHRL1, and actin (C) and to PE-conjugated anti-active caspase-3 staining (D). Shown is a representative from three independent experiments.

View larger version (35K): [in this window] [in a new window]   FIGURE 5. Akt3 siRNA sensitizes MEF-Akt1,2-DKO cells to different forms of stress. Akt1,2-DKO cells were transfected with 0.1 nM Akt3-si-1. After 48 h, doxorubicin (A), camptothecin (B), H2O2 (C), or thapsigargin (D) was added at the indicated concentration for 24 h. DAPI staining analysis of apoptotic cells was conducted as described under "Materials and Methods." Shown is the mean ± S.D. from three independent experiments.

Akt3-siRNA Sensitizes MEF-Akt1,2-DKO Cells to Stress-induced Apoptosis—Because Akt has been shown to protect cells from a variety of stimuli-induced cell death (32), we hypothesized that Akt3 siRNA would sensitize MEF-Akt1,2-DKO cells to stress-induced apoptosis. We therefore tested the effects of Akt3 siRNA (at low concentrations) in combination with the different forms of stress including genotoxic stress (doxorubicin and camptothecin), oxidative stress (H₂O₂), and ER stress (thapsigargin). As shown in Fig. 5A, Akt3-si-1 and Akt3-si-c treatment in MEF-Akt1,2-DKO cells induced 4 and 2% apoptosis, respectively. Treatment with doxorubicin and the control RNA Akt3-si-c induced 2, 7, 28, and 34% apoptosis at 0.125, 0.25, 0.5, and 1 µM doxorubicin, respectively (Fig. 5A). However, combination treatment with Akt3-si-1 and doxorubicin resulted in 8, 35, 72, and 84% apoptosis at 0.125, 0.25, 0.5, and 1 µM doxorubicin (Fig. 5A), respectively, indicating a synergistic effect. Similar results were obtained from camptothecin, H₂O_2, and thapsigargin (Fig. 5, B–D). This synergistic effect was achieved with only 0.1 nM of Akt3-si-1, which is not sufficient to induce apoptosis by itself. This suggests that cells need more Akt for survival when they are challenged with other apoptotic stimuli.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A Threshold of Akt Inhibition Is Required for Apoptosis Induction—Our data indicate that more than an 80% reduction in Akt3 protein levels is required to significantly inhibit the phosphorylation of Akt substrate FKHRL1, under which condition apoptosis was observed. Although a 51% reduction of Akt3 by 0.1 nM Akt3-si-1 had a partial effect on the phosphorylation of Akt and FKHRL1, it had no effect on apoptosis induction in MEF-Akt1,2-DKO cells (Fig. 2). Given that Akt1 and Akt2 are also present in wild-type MEF cells (Fig. 1), this suggests that probably more than 80% inhibition of total Akt is required in wild-type MEF cells for the induction of apoptosis. Furthermore, the phospho-Akt levels are similar in all four MEF cell lines (Fig. 1), indicating that only a small portion of total Akt is activated under normal cell culture conditions (10% fetal bovine serum in DMEM) in wild-type MEF cells, and there is a high level of Akt activity reserved for cells under stress. Although Akt proteins play critical roles in preventing cells from undergoing apoptosis, there is evidence that their anti-apoptotic functions are probably redundant. Down-regulation of Akt by Akt1 or Akt2 siRNAs in HeLa cells did not cause HeLa cells to undergo apoptosis (23). Moreover, Akt1 and Akt2 are dispensable for cell survival in isolated osteoclast precursors (24). The fact that only a small portion of total Akt is in the active state may explain why Akt1 or Akt2 is dispensable for the survival of certain cells.

Overexpression of Akt3 is able to rescue Akt3 siRNA-induced apoptosis in MFE-Akt1,2-DKO cells, indicating the anti-apoptotic function of Akt3. On the other hand, overexpression of Akt1 is able to restore the phosphorylation of Akt and FKHRL1 and to inhibit Akt3 siRNA-induced apoptosis in MFE-Akt1,2-DKO cells. Moreover, Akt3-si-1 did not induce apoptosis in MEF-Akt2-KO and MEF-Akt1-KO cells, even more than 80% of Akt3 protein was reduced. This indicates that Akt1, Akt2, and Akt3 have redundant anti-apoptotic functions in cells. As Akt1 overexpression did not completely rescue Akt3 siRNA from cytotoxicity, the cytotoxicity may have arisen from co-treatment with transfection reagents and adenovirus infection.

Akt3 siRNA Sensitizes MEF-Akt1,2-DKO Cells to Stress-induced Apoptosis—Doxorubicin and camptothecin are genotoxic topoisomerase II and topoisomerase I inhibitors, respectively. Hydrogen peroxide is an oxidative agent. Thapsigargin inhibits the ER calcium ATPase and blocks the sequestration of calcium by the ER, resulting in increased intracellular calcium, accumulation of misfolded proteins, and activation of apoptosis. Akt3-si-1 at low concentrations reduced Akt3 protein but had little effect on the survival of MEF-Akt1,2-DKO cells (Fig. 2). More than additive apoptosis induction was observed in MEF-Akt1,2-DKO cells treated with 0.1 nM Akt3-si-1 and genotoxic agents (doxorubicin and camptothecin), an oxidative agent (hydrogen peroxide), and an ER stress agent (thapsigargin). Our data indicate that down-regulation of Akt3 is able to sensitize MEF-Akt1,2-DKO cells to stress-induced apoptosis. It also suggests that, although only a small portion of total Akt is required for cell survival under normal growth condition, more Akt is required for cell survival when cells are challenged by different forms of stress. This provides a scientific basis for using a combination therapy of Akt inhibitors and conventional chemotherapy in clinical setting.

	FOOTNOTES

 
^* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence may be addressed: Dept. R47S, Cancer Research, Abbott Laboratories, 100 Abbott Park Rd., Abbott Park, IL 60064. Tel.: 847-938-4409; Fax: 847-938-2365; E-mail: xuesong.liu{at}abbott.com. ² To whom correspondence may be addressed: Dept. R47S, Cancer Research, Abbott Laboratories, 100 Abbott Park Rd., Abbott Park, IL 60064. Tel.: 847-835-6811; E-mail: Yan.luo{at}abbott.com.

³ The abbreviations used are: PKB, protein kinase B; PH, pleckstrin homology; PDK, 3-phosphinositide-dependent kinase; MEF, mouse embryonic fibroblast; MEF-Akt1-KO, Akt1 knock-out MEF cells; KO, knock-out cells; DKO, double knock-out cells; Z-VAD-fmk, benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone; GSK, glycogen synthase kinase; PE, phycoerythrin; DAPI, 4,6-diamidino-2-phenylindole; LF200, Lipofectamine 2000 reagent; FKHRL1, forkhead transcription factor; siRNA, small interfering RNA; DMEM, Dulbecco's modified Eagle's medium; CMV, cytomegalovirus; ER, endoplasmic reticulum.

	ACKNOWLEDGMENTS

 
We thank Drs. Joel Leverson and Edward Han for critically reading the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Datta, S. R., Brunet, A., and Greenberg, M. E. (1999) Genes Dev. 13, 2905–2927[Free Full Text]
2. Staal, S. P. (1987) Proc. Natl. Acad. Sci.U. S. A. 84, 5034–5037[Abstract/Free Full Text]
3. Bellacosa, A., Testa, J. R., Staal, S. P., and Tsichlis, P. N. (1991) Science 254, 274–277[Abstract/Free Full Text]
4. Jones, P. F., Jakubowicz, T., Pitossi, F. J., Maurer, F., and Hemmings, B. A. (1991) Proc. Natl. Acad. Sci.U. S. A. 88, 4171–4175[Abstract/Free Full Text]
5. Coffer, P. J., and Woodgett, J. R. (1991) Eur. J. Biochem. 201, 475–481[Medline] [Order article via Infotrieve]
6. Cheng, J. Q., Godwin, A. K., Bellacosa, A., Taguchi, T., Franke, T. F., Hamilton, T. C., Tsichlis, P. N., and Testa, J. R. (1992) Proc. Natl. Acad. Sci.U. S. A. 89, 9267–9271[Abstract/Free Full Text]
7. Nakatani, K., Sakaue, H., Thompson, D. A., Weigel, R. J., and Roth, R. A. (1999) Biochem. Biophys. Res. Commun. 257, 906–910[CrossRef][Medline] [Order article via Infotrieve]
8. Masure, S., Haefner, B., Wesselink, J. J., Hoefnagel, E., Mortier, E., Verhasselt, P., Tuytelaars, A., Gordon, R., and Richardson, A. (1999) Eur. J. Biochem. 265, 353–360[Medline] [Order article via Infotrieve]
9. Cho, H., Thorvaldsen, J. L., Chu, Q., Feng, F., and Birnbaum, M. J. (2001) J. Biol. Chem. 276, 38349–38352[Abstract/Free Full Text]
10. Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., III, Kaestner, K. H., Bartolomei, M. S., Shulman, G. I., and Birnbaum, M. J. (2001) Science 292, 1728–1731[Abstract/Free Full Text]
11. Easton, R. M., Cho, H., Roovers, K., Shineman, D. W., Mizrahi, M., Forman, M. S., Lee, V. M. Y., Szabolcs, M., de-Jong, R., Oltersdorf, T., Ludwig, T., Efstratiadis, A., and Birnbaum, M. J. (2005) Mol Cell. Biol. 25, 1869–1878[Abstract/Free Full Text]
12. Garofalo, R. S., Orena, S. J., Rafidi, K., Torchia, A. J., Stock, J. L., Hildebrandt, A. L., Coskran, T., Black, S. C., Brees, D. J., Wicks, J. R., McNeish, J. D., and Coleman, K. G. (2003) J. Clin. Investig. 112, 197–208[CrossRef][Medline] [Order article via Infotrieve]
13. Franke, T. F., Yang, S. I., Chan, T. O., Datta, K., Kazlauskas, A., Morrison, D. K., Kaplan, D. R., and Tsichlis, P. N. (1995) Cell 81, 727–736[CrossRef][Medline] [Order article via Infotrieve]
14. Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G. F., Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F., Tempst, P., Coadwell, J., and Hawkins, P. T. (1998) Science 279, 710–714[Abstract/Free Full Text]
15. Franke, T. F., Kaplan, D. R., Cantley, L. C., and Toker, A. (1997) Science 275, 665–668[Abstract/Free Full Text]
16. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. (1997) Curr. Biol. 7, 261–269[CrossRef][Medline] [Order article via Infotrieve]
17. Balendran, A., Casamayor, A., Deak, M., Paterson, A., Gaffney, P., Currie, R., Downes, C. P., and Alessi, D. R. (1999) Curr. Biol. 9, 393–404[CrossRef][Medline] [Order article via Infotrieve]
18. Persad, S., Attwell, S., Gray, V., Mawji, N., Deng, J. T., Leung, D., Yan, J., Sanghera, J., Walsh, M. P., and Dedhar, S. (2001) J. Biol. Chem. 276, 27462–27469[Abstract/Free Full Text]
19. Toker, A., and Newton, A. C. (2000) J. Biol. Chem. 275, 8271–8274[Abstract/Free Full Text]
20. Feng, J., Park, J., Cron, P., Hess, D., and Hemmings, B. A. (2004) J. Biol. Chem. 279, 41189–41196[Abstract/Free Full Text]
21. Sarbassov, D. D., Guertin, D. A., Ali, S. M., and Sabatini, D. M. (2005) Science 307, 1098–1101[Abstract/Free Full Text]
22. Blume, J. P., and Hunter, T. (2001) Nature 411, 355–365[CrossRef][Medline] [Order article via Infotrieve]
23. Czauderna, F., Fechtner, M., Aygün, H., Arnold, W., Klippel, A., Giese, K., and Kaufmann, J. (2003) Nucleic Acids Res. 31, 670–682[Abstract/Free Full Text]
24. Sugatani, T., and Hruska, K. A. (2005) J. Biol. Chem. 280, 3583–3589[Abstract/Free Full Text]
25. Luo, Y., Shoemaker, A. R., Liu, X., Woods, K. W., Thomas, S. A., de Jong, R., Han, E. K., Li, T., Stoll, V. S., Powlas, J. A., Oleksijew, A., Mitten, M. J., Shi, Y., Guan, R., McGonigal, T. P., Klinghofer, V., Johnson, E. F., Leverson, J. D., Bouska, J. J., Mamo, M., Smith, R. A., Gramling-Evans, E. E., Zinker, B. A., Mika, A. K., Nguyen, P. T., Oltersdorf, T., Rosenberg, S. H., Li, Q., and Giranda, V. L. (2005) Mol. Cancer Ther. 4, 977–986[Abstract/Free Full Text]
26. Mandal, M., Kim, S., Younes, M. N., Jasser, S. A., El Naggar, A. K., Mills, G. B., and Myers, J. N. (2005) Br. J. Cancer 92, 1899–1905[CrossRef][Medline] [Order article via Infotrieve]
27. Martelli, A. M., Tazzari, P. L., Tabellini, G., Bortul, R., Billi, A. M., Manzoli, L., Ruggeri, A., Conte, R., and Cocco, L. (2003) Leukemia (Basingstoke) 17, 1794–1805
28. Ahn Jee, Y., Rong, R., Liu, X., and Ye, K. (2004) EMBO J. 23, 3995–4006[CrossRef][Medline] [Order article via Infotrieve]
29. Todaro, G. J., and Green, H. (1963) J. Cell Biol. 17, 299–313[Medline] [Order article via Infotrieve]
30. Liu, X., Powlas, J., Shi, Y., Oleksijew, A., Shoemaker, A. R., De Jong, R., Oltersdorf, T., Giranda, V. L., and Luo, Y. (2004) Anticancer Res. 24, 2697–2704[Medline] [Order article via Infotrieve]
31. Liu, X., and Ye, K. (2005) J. Neurochem. 93, 892–898[CrossRef][Medline] [Order article via Infotrieve]
32. Clark, A. S., West, K., Streicher, S., and Dennis, P. A. (2002) Mol. Cancer Ther. 1, 707–717[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. Degtyarev, A. De Maziere, C. Orr, J. Lin, B. B. Lee, J. Y. Tien, W. W. Prior, S. van Dijk, H. Wu, D. C. Gray, et al. Akt inhibition promotes autophagy and sensitizes PTEN-null tumors to lysosomotropic agents J. Cell Biol., October 6, 2008; 183(1): 101 - 116. [Abstract] [Full Text] [PDF]

				M. M. Juntilla, J. A. Wofford, M. J. Birnbaum, J. C. Rathmell, and G. A. Koretzky Akt1 and Akt2 are required for {alpha}beta thymocyte survival and differentiation PNAS, July 17, 2007; 104(29): 12105 - 12110. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 281/42/31380    most recent M606603200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liu, X. Articles by Luo, Y. Search for Related Content PubMed PubMed Citation Articles by Liu, X. Articles by Luo, Y. Social Bookmarking                      What's this?