HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 5, 2533-2542, February 3, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/5/2533    most recent M507964200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Helton, E. S. Articles by Chen, X. Search for Related Content PubMed PubMed Citation Articles by Helton, E. S. Articles by Chen, X. Social Bookmarking                      What's this?

The Unique NH₂-terminally Deleted (N) Residues, the PXXP Motif, and the PPXY Motif Are Required for the Transcriptional Activity of the N Variant of p63^*

From the Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama 35294-0005

Received for publication, July 21, 2005 , and in revised form, November 29, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
p63, a member of the p53 family of transcription factors, is known to be involved in epithelial development. However, its role in tumorigenesis is unclear. Contributing to this uncertainty, the TP63 locus can express multiple gene products from two different promoters. Utilization of the upstream promoter results in expression of the TAp63 variant with an activation domain similar to p53. In contrast, the NH₂-terminally deleted (N) p63 variant, transcribed from a cryptic promoter in intron 3, lacks such an activation domain. Thus, the TAp63 and Np63 variants possess a wide ranging ability to up-regulate p53 target genes. Consequentially, the disparity in transactivation potential between p63 variants has given rise to the hypothesis that the Np63 variant can serve as oncoprotein by opposing the activity of the TAp63 variant and p53. However, recent studies have revealed a transcriptional activity for Np63. This study was undertaken to address the transcriptional activity of the Np63 variant. Here, we showed that all NH₂-terminally deleted p63 isoforms retain a potential in transactivation and growth suppression. Interestingly, Np63 possesses a remarkable ability to suppress cell proliferation and transactivate target genes, which is consistently higher than that seen with Np63. In contrast, Np63 has a weak or undetectable activity dependent upon the cell lines used. We also demonstrate that an intact DNA-binding domain is required for Np63 function. In addition, we found that the novel activation domain for the Np63 variant is composed of the 14 unique N residues along with the adjacent region, including a PXXP motif. Finally, we demonstrated that a PPXY motif shared by Np63 and Np63 is required for optimal transactivation of target gene promoters, suggesting that the PPXY motif is requisite for Np63 function.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
p53 functions as a tumor suppressor by transactivating target genes that mediate cell cycle arrest, apoptosis, and other p53-dependent activities. In response to DNA damage, oncogene activation, or other forms of cellular stress, p53 is stabilized by a complex series of post-translational modifications and protein-protein interactions that allow p53 to carry out its tumor suppression activity. Structurally, p53 is organized into several domains, each of which contributes to p53 transcriptional activity. p53 contains two amino-terminal activation domains, AD1 within residues 1–42 and AD2 within residues 43–92, including the proline-rich domain, which enable p53 to form direct associations with transcriptional coactivators. The DNA-binding domain allows for sequence-specific recognition of response elements in p53 target gene promoters. The tetramerization domain directs formation of the p53 tetramer required for DNA binding. Finally, the carboxyl-terminal basic domain has a regulatory function by controlling p53 stability and transcriptional activity (reviewed in Ref. 1).

p63, a member of the p53 family of transcription factors, was identified in 1998 (2, 3). Like p53, p63 contains a proline-rich domain, a DNA-binding domain, and a tetramerization domain, all of which share strong sequence similarity with p53 (reviewed in Ref. 4). Accordingly, p63 is able to regulate many p53 target genes. However, due to two transcriptional start sites, the TP63 locus is capable of expressing two major variants, called TA² and N, both of which have multiple isoforms as a result of alternative splicing at the COOH terminus. Transcribed from the upstream promoter, the TA variant contains an acidic, transcriptional activation domain (AD) similar to p53 and is able to transactivate p53 target genes as well as inhibit cell proliferation and induce apoptosis. In contrast, the Np63 variant, transcribed from the cryptic promoter in intron 3, lacks the activation domain encoded by exons 2 and 3 but gains 14 unique residues in its NH₂ terminus. Alternative splicing of p63 transcripts results in expression of at least three COOH-terminal isoforms, , , and . Thus, the TP63 gene is capable of producing at least six transcripts: p63, p63, p63, Np63, Np63, and Np63 (Fig. 1A).

The discovery of p53 family members, p73 in 1997 (5) and p63 in 1998 (2, 3), was first thought to introduce two new tumor suppressors in the fight against cancer. Although enthusiasm was initially tempered by findings that p63 and p73 do not function as classic tumor suppressors, recent evidence suggests that p63 might serve an important role in tumor suppression. Amplification and overexpression of p63 has been linked to increased survival rates in lung cancer patients (6), and loss of p63 expression has been linked to an increase in metastasis in bladder (7–9) and breast cancers (10). Likewise, fibroblasts derived from p63 knock-out mice were shown to be defective in the p53-mediated apoptotic response (11). In addition, a follow up study has demonstrated that mice heterozygous for p63 developed an increased tumor burden and metastasis rate, which was compounded in mice harboring heterozygous alleles of p53 and/or p73 (12).

Among all p63 isoforms, Np63 is the most predominantly expressed. Our laboratory and others have demonstrated that Np63 retains transcriptional activity and is competent to induce growth suppression (13). When expressed in H1299 cells, Np63 is able to inhibit cell proliferation, induce cell death, and up-regulate GADD45 (growth arrest and DNA damage-45) and p21. Importantly, these activities are dependent on the presence of the NH₂ terminus, since the Np63 construct lacking the first 26 amino acids was nonfunctional. These findings have forced the scientific community to reconsider the role of Np63 in tumor formation and development. Evidence supporting a transcriptional activity for Np63 has been demonstrated by others. For example, Np63 was shown to function both as a positive regulator of p53-responsive promoters and as a negative regulator of maturation-specific genes during Ca²⁺-induced keratinocyte differentiation (14). Similarly, small interfering RNA knockdown of Np63 in immortalized mammary epithelial cells revealed that Np63 promotes transcription of PUMA and NOXA but negatively regulates the P21 and P53 promoters (15). Finally, Np63 activates the HSP70 promoter, as well as induces hsp70 protein expression (16).

Whereas a tumor suppressor function has recently been ascribed to p63, previous studies have suggested that p63 might function as an oncogene. For example, Np63 was characterized as transcriptionally incompetent and shown to be a dominant negative to TAp63 and p53 in luciferase reporter assays (3, 17). In addition, loricrin promoter-driven expression of Np63 in the epidermis of transgenic mice hindered apoptosis induced by UV-B but did not alter epithelial cell proliferation or stratification (18). Furthermore, chromosomal arm 3q, which contains the TP63 locus, is amplified, and the Np63 transcript is overexpressed in lung cancer and squamous cell carcinomas of the head and neck (19). Likewise, TAp63 isoforms are overexpressed in certain lymphomas (20).

Debate on the function of Np63 will continue until regulation of p63-mediated target gene expression is elucidated. To gain a better understanding of the diverse activities found in the p63 isoforms, we mutated or deleted specific regions in p63. By comparing the transcriptional activity of wild-type and mutant p63 proteins in stable, inducible cell lines and in transient expression studies, we have characterized several functional domains that regulate Np63 transactivation potential. Our results demonstrated that Np63 and Np63 are capable of inducing target gene expression and inhibiting cell proliferation. We showed that these activities are dependent upon DNA binding, since DNA-binding domain mutants were inactive. In addition, we have defined the activation domain in Np63, which includes the 14 unique N residues and the adjacent proline-rich domain. Finally, our results demonstrate that a PPXY motif, present in Np63 and Np63, modulates Np63 function.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Reagents—HF-Taq polymerase and tetracycline-free fetal bovine serum were obtained from Clontech. The dual luciferase kit was obtained from Promega. The site-directed mutagenesis kit was obtained from Stratagene. Primary anti-Myc antibody was collected from the 9e10.2 hybridoma cell line. The p21(C-19) antibody was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The rabbit anti--actin antibody and horseradish peroxidase-conjugated secondary antibodies were purchased from Sigma. Unless otherwise indicated, all remaining reagents were purchased from Sigma.

Plasmids and Mutagenesis—Various Np63 constructs were generated by PCR amplification using Myc-tagged Np63 or Np63 cDNA as a template. To generate Np63(2–14), a cDNA fragment encoding residues 15–211 was amplified using 5' end primer p63–58 (5'-GAATTCCTCGAGCCACAGTACACGAACCTGGG-3') and 3' primer p63-2 (5'-TTGTACAGGACTGTTGTGAATTCAG-3'). To generate Np63(2–19), a cDNA fragment encoding residues 20–211 was amplified using 5' end primer p63-67 (5'-ACTCGAGCTGGGGCTCCTGAACAGC-3') and the 3' primer p63-2. To generate Np63(N6H), a cDNA fragment encoding residues 2–211 was amplified using 5' end primer p63-26 (5' CCTCGAGTTGTACCTGGAACACAATGCCCAGACTC 3') and the 3' primer p63-2. These cDNA fragments were digested with XhoI and BsrGI and used to replace the corresponding region in the wild-type construct.

To generate Np63(457-ter), a cDNA fragment encoding residues 199–456 was amplified using 5' end primer p63-59 (5'-CCACAGGTTGGCACTGAATTCACAACAGTCC-3') and 3' primer p63-60 (5'-TGGATCCTCAGACAATGCTGCAGTCTGTGG-3'). To generate Np63(431-ter), a cDNA fragment encoding residues 199–430 was amplified using the 5' end primer p63-59 and 3' primer p63-61 (5'-TGGATCCTCAAGCTTGGGTAGGGCTGAGTCC-3'). To generate Np63(406-ter), a cDNA fragment encoding residues 199–405 was amplified using the 5' end primer p63-59 and 3' primer p63-62 (5'-TGGATCCTCACATGCCCTCAGGCATGG-3'). To generate Np63(381-ter), a cDNA fragment encoding residues 199–380 was amplified using the 5' end primer p63-59 and 3' primer p63-63 (5'-TGGATCCTCAGACAATGCTGCAGTCTGTGG-3'). To generate Np63(356-ter), a cDNA fragment encoding residues 199–355 was amplified using 5' end primer p63-59 and 3' primer p63-355 (5'-ACGGATCCTCATTTCTGAAGTAGGTGCTG-3'). To generate Np63(Y449A), a cDNA fragment encoding residues 199–456 was amplified using the 5' end primer p63-59 and 3' primer p63-71 (5'-TGGATCCTCAGACTTGCCAAATCCTGACAATGCTGCAGTCTGTGGGGGCGGGCGGTGGTGGGGT-3'). To generate Np63(Y449D), a cDNA fragment encoding residues 199–456 was amplified using the 5' end primer p63-59 and 3' primer p63-72 (5'-TGGATCCTCAGACTTGCCAAATCCTGACAATGCTGCAGTCTGTGGGGTCGGGCGGTGGTGGGGT-3'). To generate Np63(445–449), a cDNA fragment encoding residues 199–456 was amplified using the 5' end primer p63-59 and 3' primer p63-73 (5'-TGGATCCTCAGACTTGCCAAATCCTGACAATGCTGCAGTCTGTGGGGGTGCAGTGGGAGG-3'). These cDNA fragments were digested with BamHI and BsrGI and used to replace the corresponding region in the wild-type construct.

To generate Np63(R149W), a cDNA fragment encoding residues 135–215 was amplified using 5' end primer p63-1 (5'-CCTGTCTACAAGAAAGCTGAGCATGTCACCGAGGTTGTGAAATGGTGCCCTAACCAT-3') and the 3' primer p63-2. This cDNA fragment was digested with AccI and BsrGI and used to replace the corresponding region in the wild-type construct.

To generate Np63(L22Q,L23S), a cDNA fragment encoding residues 35–215 was amplified using 5' end primer p63-5QS (5'-TTCAGAACGGATCCTCGTCCACCAGCC-3') and the 3' primer p63-2. An additional cDNA fragment encoding residues 1–34 with point mutations at residues 22 and 23 (L22Q,L23S) was amplified from wild-type Np63 in pcDNA3 using 5' end primer T7 (5'-TAATACGACTCACTATAGGG-3') and 3' primer p63-3QS (5'-GGACGAGGATGGGTTCTGAATCTGCTGGTCCATGCTGTTCGACTGCCCCAGGTTC-3'). Following digestion with EcoRI and BamHI, a three-piece ligation was used to replace the corresponding region in the wild-type construct.

Site-directed mutagenesis was performed using the Stratagene QuikChange kit. To generate Np63(R243Q), the entire construct was amplified using 5' end primer (5'-GCAAGTCCTGGGCCAACGGTGCTTTGAGG-3') and 3' end primer (5'-CGTTCAGGACCCGGTTGCCACGAAACTCC-3'). To generate Np63(R249W), the entire construct was amplified using 5' end primer (5'-CGGTGCTTTGAGGCCTGGATCTGTGCTTGCCCA-3') and 3' end primer (5'TGGGCAAGCACAGATCCAGGCCTCAAAGCACCG-3'). To generate Np63(P72A), the entire construct was amplified using 5' end primer (5'-CTCCATCCCCTGCCATTGCCTCCAACACAGATTACCCG-3') and 3' end primer (5'-CGGGTAATCTGTGTTGGAGGCAATGGCAGGGGATGGAG-3'). To generate Np63(PXXP), in which residues thus allowing for deletion of residues 69–72 are deleted, the entire construct was amplified using 5' end primer (5'-GCCCTCTCTCCATCCTCCAACACAGATTACCCG-3') and 3' end primer (5'-CGGGTAATCTGTGTTGGAGGATGGAGAGAGGGC-3'). All mutations were confirmed by DNA sequencing.

The reporter constructs, pGL2-basic-p21 (full-length promoter), pGL2-Fos-GADD45 (intron 1 RE), and pGL2-basic-FDXR (ferredoxin reductase) (–56 to +11 promoter) were described in previous studies (21–23).

Cell Culture and Stable Transfections—Stable cell lines were generated using the tetracycline-off system as previously described (24). Transfections were carried out using the calcium phosphate precipitation method (25).

Growth Curve Analysis—The overall viability of each cell line was addressed by growth curve analysis, as previously described (26). Briefly, 5 x 10⁴ H1299 and 1 x 10⁵ MCF-7 cells were plated per 6-cm dish and either induced (without tetracycline) or uninduced (with tetracycline). Adherent cells were counted at 24-h intervals over 5 days in culture using a Coulter cell counter. Medium was changed at day 3 for both control and experimental cell groups.

DNA Histogram Analysis—The assay was carried out using a FACS-Caliber cell sorter (BD Biosciences) as previously described (24). Briefly, 3 x 10⁵ cells were plated per 10-cm dish. H1299 and MCF-7 cells were induced or uninduced to express various Np63 proteins for 3 days. Trypsinized, adherent cells and floating cells were combined, washed with phosphate-buffered saline, pH 7.4 (PBS), and fixed in 100% ethanol. When ready to stain, cells were washed with PBS and resuspended in staining buffer with 100 µg/ml RNase A and 50 µg/ml propidium iodine (Molecular Probes, Inc., Eugene, OR). RNA was digested, and cells were stained for 30 min at room temperature. The percentage of cells in each phase of the cell cycle (G₁, S, and G₂-M) was analyzed using Cell Quest software, with sub-G₁ accumulation being used as a marker for apoptosis.

Trypan Blue Dye Exclusion—H1299 and MCF-7 cells were induced or uninduced to express various Np63 proteins for 3 days. Trypsinized, adherent cells and floating cells were collected and stained with trypan blue dye for 5 min. Both live (unstained) and dead (stained) cells were counted two times using a hemocytometer. Results are expressed as a percentage of dead cells over total cells counted.

Western Blot Analysis—Cells were plated at a density of 2.5 x 10⁶ cells/10-cm dish and incubated for 24 h. Following induction, plates were washed with cold PBS (pH 7.4) and collected in 500 µlof2x SDS sample buffer and heated for 7 min at 95 °C. SDS-PAGE and Western blots were carried out as previously described (27). Nitrocellulose membranes were blocked with 5% dry milk in PBS with 0.1% Tween 20 (PBST) for 30 min, incubated in primary antibody overnight at 4 °C or for 2 h at room temperature, and washed three times for 10 min in PBST, and then the membrane was incubated in horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature and washed four times in PBST. Blots were developed using Pierce Pico-West reagents, followed by exposure to x-ray film. All antibody dilutions were carried out with 2% dry milk in PBST.

Northern Blot Analysis—Cells were plated at a density of 2.5 x 10⁶ cells/10-cm dish and incubated for 24 h. Following induction, plates were washed with cold PBS (pH 7.4) and collected in 1.0 ml of Trizol reagent (Invitrogen). Total RNA was isolated following the manufacturer's instructions. Northern blots were prepared using 10 µg of total RNA. The P21, DKK1 (DICKKOPF-1), PIG3 (p53-induced gene-3), GADD45, FDXR, and GAPDH probes were prepared as previously described (27, 28). Blots were exposed to x-ray film and quantified by densitometry.

Luciferase Assays—Transient transfections were carried out using the calcium phosphate precipitation method (25). Briefly, p53-null H1299 cells were plated at 5 x 10⁴ cells/well in 12-well plates and allowed to recover overnight. Using the calcium phosphate method, cells were co-transfected with 100 ng of wild-type or mutant p63 construct in pcDNA3 and 100 ng of pGL2 reporter vector/well. As an internal control, 5 ng of pRL-CMV, a Renilla luciferase vector (Promega), was also co-transfected per well. 36 h post-transfection, cells were washed with cold PBS and lysed in 150 µl of passive lysis buffer. Luciferase activity was measured using the Promega dual luciferase kit and a Turner Designs luminometer. The -fold increase in relative luciferase activity was the product of the luciferase activity induced by pcDNA3 constructs expressing wild-type or mutant p63 divided by that induced by a pcDNA3 empty control vector.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
All Np63 Isoforms Have the Potential to Inhibit Cell Proliferation—To determine the role of Np63 isoforms in cell cycle progression and cell death, stable cell lines were created using the tetracycline-off system. H1299, a p53-null lung cancer cell line, was utilized to determine the p53-independent function of Np63 isoforms. Previously published data from our laboratory demonstrate that tetracycline does not alter H1299 cell proliferation (29). Multiple cell lines were generated, and two representative cell lines for each Np63 isoform were selected for further study. As shown in Fig. 1B, these cell lines were able to inducibly express Np63, Np63, or Np63. In addition, the protein level of each isoform was comparable (Fig. 1B). To determine the transcriptional activity of each isoform, we monitored the level of p21^WAF1, a known p53 target gene. Similar to our previous finding (13), Np63 was able to induce a modest increase in p21 expression. Whereas p21 expression was weakly induced by Np63, Np63 was highly active in inducing this p53 target gene. To determine the ability of Np63 isoforms to inhibit cell proliferation, growth rate analysis was performed (Fig. 1C). Consistent with our previous report, Np63 reduced the proliferation potential of H1299 cells by day 3 (13). Furthermore, we showed that Np63 and Np63 were capable of inhibiting cell proliferation, with Np63 displaying the greatest ability to induce growth suppression, followed by Np63 and then Np63 (Fig. 1C).

To characterize the decreased proliferative potential of H1299 cells seen in our growth curve assay, trypan blue dye exclusion studies were performed as an indicator of cell viability (Fig. 1D). Following induction of Np63, we observed a significant increase in the number of trypan blue-positive, nonviable cells over that seen for uninduced controls. Likewise, we observed a moderate increase in nonviable cells upon induction of Np63. In contrast, there was no difference in the viability of control cells and those induced to express Np63. In addition, DNA histogram analysis was performed to determine the cell cycle profile of these cells in the presence or absence of each Np63 isoform (Fig. 1E). We found that sub-G₁ accumulation, associated with apoptotic cell death, was increased upon induction of Np63 and Np63. We also found that Np63 and Np63 induced cell cycle arrest, primarily in G₁ phase. Upon induction of Np63, cell cycle arrest in G₁ phase, but not significant apoptosis, was detected in both Np63-expressing cell lines. Taken together, these results demonstrate that Np63 and Np63 can induce cell death.

To rule out the possibility that these Np63 activities are cell type-specific, we used MCF-7 breast adenocarcinoma cells to produce additional stable cell lines. Unpublished results from our laboratory have demonstrated that tetracycline does not alter MCF-7 cell proliferation. Multiple cell lines inducibly expressing Np63, Np63, or Np63 were generated, and two representative clones were chosen for further studies. Western blot analysis was performed to determine the level of protein expressed (Fig. 2A). We found that these Np63 isoforms were expressed at a comparable level and that p21 was up-regulated by Np63 but not by Np63 and Np63. Similar to our results observed in H1299 cells, growth curve analysis demonstrated that Np63 and Np63 inhibited cell proliferation, whereas Np63 was almost inert (Fig. 2B). It is noteworthy that p21 induction was low in Np63, suggesting that a target gene other than p21 was responsible for mediating Np63-dependent growth suppression.

View larger version (49K): [in this window] [in a new window]   FIGURE 1. Np63 isoforms possess varied abilities to induce target gene expression and inhibit cell proliferation in H1299 cells. A, schematic representation of TP63 gene and gene products. PRD, proline-rich domain; DBD, DNA-binding domain; TD, tetramerization domain; SAM, sterile motif. B, generation of stable H1299 cell lines inducibly expressing Np63 isoforms. Two cell line clones for each isoform (Np63-11, Np63-22, Np63-14, Np63-29, Np63-25, and Np63-4) were utilized in this study. Western blots were performed on extracts collected 24 h postinduction from control cells (–p63) and induced cells (+p63). Myc-tagged p63 was detected with anti-Myc antibody (9e10.2). p21 was detected with anti-p21 antibody (C19). Actin was detected with an anti-actin polyclonal antibody. C, growth curve analysis was performed over a 5-day period as described under "Experimental Procedures" (numerals in the graph titles refer to clonal isolate number). D, cell viability was determined by counting live (unstained) and dead (stained) cells following staining with trypan blue dye. E, DNA content was quantified following propidium iodide staining of fixed cells that were cultured for 3 days in the presence (–p63) or absence (+p63) of tetracycline.

DNA Binding Is Essential for p63 Function—Most hotspot mutations found in TP53 are located in the DNA-binding domain. These mutations, characterized as either contact site or conformational mutants, are often associated with loss of tumor suppressor function. Similar mutations, associated with EEC syndrome (reviewed in Ref. 30), have been identified in the DNA-binding domain of TP63. To test the effect of DNA-binding domain mutations on p63 function, we established MCF-7 cell lines inducibly expressing Np63(R149W), carrying a point mutation corresponding to arginine 204 in TAp63 and to arginine 175 in p53 (Fig. 4A). Multiple cell lines were generated, and two representative clones were used for further study. Western blot analysis was performed and revealed that the level of Np63(R149W) was equal to or greater than wild-type Np63 (Fig. 4B). Consistent with our earlier published reports (13), Northern blot analysis demonstrated that Np63 was transcriptionally active in MCF-7 cells and induced expression of the FDXR, GADD45, and P21 genes (Fig. 4C). However, contrary to wild-type Np63, the transcriptional activity of the R149W mutant was abrogated (Fig. 4C). Consequentially, Np63(R149W) were unable to suppress cell proliferation (Fig. 4D). These results suggest that an intact DNA-binding domain is required for Np63 function.

View larger version (31K): [in this window] [in a new window]   FIGURE 2. The Np63 isoforms are functional in MCF-7 cells. A, generation of stable MCF-7 cell lines inducibly expressing Np63 isoforms. Two cell line clones for each isoform (Np63-4, Np63-9, Np63-1, Np63-4, Np63-10, and Np63-18) were utilized in this study (numerals refer to clonal isolate number). Western blot analysis was performed to determine levels of p63, p21, and actin in extracts collected 24 h postinduction from control cells (–p63) and induced cells (+p63). B, growth curve analysis was performed over a 5-day period as described under "Experimental Procedures" (numerals in graph titles refer to clonal isolate number).

View larger version (63K): [in this window] [in a new window]   FIGURE 3. Unique sequences in the NH2 terminus and COOH terminus of p63 isoforms differentially regulate their ability to induce endogenous target genes. Northern blots were prepared using 10 µg of RNA purified from uninduced (–p63) and induced cells (+p63) cultured for 1 day or 7 days post-induction. Blots were analyzed with cDNA probes for P21, DKK1, PIG3, and GADD45, as indicated to the right of the blot. GAPDH was utilized as a loading control. Lanes 1–16 are labeled at the bottom.

Np63 Isoforms Differ in Their Ability to Activate the p53 Target Gene Promoters—To better understand the contribution of specific amino acid sequences to p63 function, we characterized the ability of wild-type and mutant p63 constructs to activate p53-responsive promoters. As determined by Western blot analysis, Np63 and Np63 were expressed at equivalent levels, whereas the level of Np63 was slightly higher following transient transfection in H1299 (Fig. 7A). To measure the transactivation potential of the wild-type Np63 isoform, each Np63-expressing vector was co-transfected with a luciferase reporter construct into the p53-null H1299 cells (Fig. 7B). We showed that Np63, Np63, and Np63 differentially regulated the P21, GADD45, and FDXR reporters (Fig. 7B). Similar to the results obtained in the stable cell line studies, luciferase reporter assays demonstrated that Np63 was highly potent, whereas Np63 was limited, to transactivate P21, GADD45, and FDXR promoters. However, transiently expressed Np63 was unable to transactivate these promoters.

Np63 DNA-binding Domain Mutants Exhibit Loss of Function—Among Np63 isoforms, Np63 is the most potent in transactivation and in inducing cell cycle arrest and apoptosis. Thus, the remaining studies to analyze the domain and function of Np63 were carried out with the Np63 isoform. Since mutations in the DNA-binding domain of p63 have been identified in several developmental disorders, we utilized these mutants to demonstrate a requirement for DNA binding for p63 function (reviewed in Refs. 30 and 34). For example, codons corresponding to arginine 149 and arginine 249 were found to be mutated in EEC syndrome, whereas arginine 243 was found to be mutated in ADULT syndrome (Fig. 4A). These mutants were generated and used for luciferase assay. As revealed in Fig. 8A, both wild-type and mutant Np63 constructs were expressed at comparable levels. To determine their transactivation potential, these DNA-binding domain mutants were analyzed for their ability to activate the P21, GADD45, and FDXR reporter constructs (Fig. 8B). Consistent with data obtained from Np63(R149W)-expressing cell lines (Fig. 4), Np63(R149W) showed a complete lack of transcriptional activity for all reporter constructs (Fig. 8B). Likewise, Np63(R243Q) was inactive. Surprisingly, we found that Np63(R249W) was able to activate the P21, GADD45, and FDXR reporters, albeit less than the wild-type protein (Fig. 8B). These data suggest that the DNA-binding domain is necessary for Np63 activity and that some critical residues in the p53 DNA-binding domain are conserved in p63, whereas others are not.

View larger version (27K): [in this window] [in a new window]   FIGURE 4. The DNA-binding domain is required for Np63 to inhibit cell proliferation in MCF-7 cells. A, the DNA-binding domains of p63 and p53 are 60% identical. Residues identified as hot spot mutations for p53 are conserved in p63. Nonconserved residues are denoted by a dash. B, generation of stable MCF-7 cell lines, clones 30 and 50, inducibly expressing Np63(R149W). Western blot analysis of Myc-tagged p63 and actin was performed on extracts collected 24 h postinduction from Np63(R149W) control cells (–p63) and induced cells (+p63). C, Northern blots were prepared using 10 µg of RNA purified from uninduced (–p63) and induced cells (+p63) cultured for 24 h postinduction. Blots were analyzed with cDNA probes for FDXR, GADD45, and P21 genes as indicated to the right of the blot. GAPDH was utilized as a loading control. D, growth curve analysis was performed over a 5-day period as described under "Experimental Procedures" (numerals in graph titles refer to clonal isolate number).

View larger version (20K): [in this window] [in a new window]   FIGURE 5. The Np63(N6H) mutation associated with ADULT syndrome modestly compromises protein function. A, generation of stable MCF-7 cell lines, clones 4 and 35, inducibly expressing Np63(N6H). Western blot analysis of Myc-tagged p63 and actin was performed on extracts collected 24 h postinduction from control cells (–p63) and induced cells (+p63). B, growth curve analysis was performed over a 5-day period as described under "Experimental Procedures" (numerals in graph titles refer to clonal isolate number).

View larger version (19K): [in this window] [in a new window]   FIGURE 6. Mutation of a PXXP motif in Np63 adversely affects protein function. A, generation of stable MCF-7 cell lines, clones 3 and 60, inducibly expressing Np63(P72A). Western blot analysis of Myc-tagged p63 and actin was performed on extracts collected 24 h postinduction from control cells (–p63) and induced cells (+p63). B, growth curve analysis was performed over a 5-day period as described under "Experimental Procedures" (numerals in graph title refer to clonal isolate number).

View larger version (17K): [in this window] [in a new window]   FIGURE 7. Np63 isoforms differ in their ability to activate p53 target gene promoters following transient transfection. A, the levels of Np63 isoforms and actin were assayed by Western blot analysis of extracts collected 24 h following transient transfection utilizing anti-Myc antibody for Myc-tagged p63 and anti-actin antibody. B, transcriptional activity of Np63, Np63, and Np63 was determined by luciferase assay following cotransfection with pGL2-p21, pGL2-GADD45, or pGL2-FDXR. The -fold increase in relative luciferase activity was calculated using an empty pcDNA3 vector as a control.

View larger version (19K): [in this window] [in a new window]   FIGURE 8. DNA-binding domain mutants greatly reduce the transactivation potential of Np63. A, the levels of wild type, DNA-binding domain mutants, and actin were assayed by Western blot analysis of extracts collected 24 h following transient transfection utilizing anti-Myc antibody for Myc-tagged p63 and anti-actin antibody. B, transcriptional activity of DNA-binding domain mutants for Np63 was determined by luciferase assay following cotransfection with pGL2-p21, pGL2-GADD45, or pGL2-FDXR.

View larger version (27K): [in this window] [in a new window]   FIGURE 9. The 14 unique N residues and adjacent region form an activation domain for Np63 isoforms. A, schematic diagram of NH2-terminal deletion and point mutation constructs for Np63. B, levels of p63 and actin were assayed by Western blot analysis using anti-Myc antibody for Myc-tagged p63 and anti-actin antibody. C, transcriptional activity of Np63 carrying mutations in NH2-terminal residues was determined by luciferase assay following cotransfection with pGL2-p21. The -fold increase in relative luciferase activity was calculated using an empty pcDNA3 vector as a control. D, the levels of p63, p21, and actin expressed in wild-type Np63 and Np63(P72A) were assayed by Western blot analysis.

View larger version (31K): [in this window] [in a new window]   FIGURE 10. Residues 431–455 in Np63 are critical for its strong transcriptional activity. A, schematic diagram of COOH-terminal deletion constructs. B, levels of p63 and actin were assayed by Western blot analysis. C, transcriptional activity of Np63 isoforms and COOH-terminal truncation mutants was determined by luciferase assay following cotransfection with pGL2-p21.

A COOH-terminal PPXY Motif Confers Increased Transactivation Potential to Np63—PPXY motifs serve as ligands for WW domain-containing proteins. Recently, studies showed that p73, another p53 family member, contains a PPXY motif that can be regulated by WW domain-containing proteins (36–39). Thus, we searched for such a motif between residues 431 and 455 and found a PPXY motif present in the and isoforms (Fig. 11A). To explore the role of the PPXY motif in p63 function, three mutants, which disrupt the PPXY motif, were generated (Fig. 11B). Western blot showed that both wild-type and mutant Np63 constructs were expressed at equivalent levels (Fig. 11C). Interestingly, these mutants exhibited a reduced ability to activate the P21 promoter (Fig. 11D). Nevertheless, the PPXY mutants of Np63 were still more potent than Np63 to activate the P21 promoter (Fig. 11D). These data suggest that the PPXY motif and additional amino acids between residues 431 and 455 are capable of enhancing the transcriptional activity of Np63.

View larger version (32K): [in this window] [in a new window]   FIGURE 11. Point mutation or deletion of the PPXY motif attenuates the ability of Np63 to transactivate the p21 promoter. A, alignment of p63 and p73 COOH-terminal residues including a conserved PPXY motif. B, schematic presentation of the Np63 COOH terminus proline-rich domain. The PPXY motif is disruped by point mutation in Np63(Y449A) and Np63(Y449D) or by deletion in Np63(445–449). Dashes represent deleted residues. C, Western blot analysis of p63 and actin in H1299 cells transfected with wild-type Np63 and PPXY mutants. D, transcriptional activity of Np63 and mutants carrying mutations in the PPXY motif was determined by luciferase reporter assay following cotransfection with pGL2-p21.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES